Log In Sign up
The largest database of trusted experimental protocols

Spriselect purification

Manufactured by Illumina
Visit Supplier

SPRIselect is a magnetic bead-based reagent used for the purification and size-selection of nucleic acids. It enables efficient removal of unwanted fragments, primers, and salts from various sample types, including DNA, RNA, and libraries. The product functions by binding nucleic acids to magnetic beads, allowing for simple wash and elution steps to isolate the desired molecules.

Automatically generated - may contain errors

Lab products found in correlation

Seqamp polymerase, by Takara Bio (2 mentions) Smartscribe reverse transcriptase, by Takara Bio (2 mentions)

2 protocols using spriselect purification

1

Bulk Sequencing of Antigen-Specific T Cells

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
For the bulk sequencing of sorted antigen-specific T cells, we used our previously published protocol for repertoire sequencing with purified mRNA as the template with some modifications26 (link). In short, the method is based on the template switch mechanism in the reverse transcriptase which adds an anchor sequence at the 3’ end of the new synthesized ss cDNA (Clontech’s SMARTScribe TM reverse transcriptase). The template switch oligo also includes random nucleotides for unique molecular barcoding (isoC-GCGTCAGATGTGTATAAGAGACAGNNNNNNNNNNrGrGrG). The whole transcriptome was amplified with Clontech SeqAmp Polymerase. Based on the obtained ds cDNA as template TCR specific amplification was succeeded through a specific TCR constant primer (TRB: TGCTTCTGATGGCTCAAACACAGCG) using the NEB Q5 polymerase. Beckmann SPRIselect purification was used to clean the PCR product before sequencing on Illumina MiSeq. Filtering and merging of reads were done as previously described and VDJ and CDR3 annotations were assigned using IMGT/HighV-Quest (IMGT®).
Huang H., Wang C., Rubelt F., Scriba T.J, & Davis M.M. (2020). Analyzing the M. tuberculosis immune response by T cell receptor clustering with GLIPH2 and genome-wide antigen screening. Nature biotechnology, 38(10), 1194-1202.
+ Open protocol
+ Expand
2

Bulk Sequencing of Antigen-Specific T Cells

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
For the bulk sequencing of sorted antigen-specific T cells, we used our previously published protocol for repertoire sequencing with purified mRNA as the template with some modifications26 (link). In short, the method is based on the template switch mechanism in the reverse transcriptase which adds an anchor sequence at the 3’ end of the new synthesized ss cDNA (Clontech’s SMARTScribe TM reverse transcriptase). The template switch oligo also includes random nucleotides for unique molecular barcoding (isoC-GCGTCAGATGTGTATAAGAGACAGNNNNNNNNNNrGrGrG). The whole transcriptome was amplified with Clontech SeqAmp Polymerase. Based on the obtained ds cDNA as template TCR specific amplification was succeeded through a specific TCR constant primer (TRB: TGCTTCTGATGGCTCAAACACAGCG) using the NEB Q5 polymerase. Beckmann SPRIselect purification was used to clean the PCR product before sequencing on Illumina MiSeq. Filtering and merging of reads were done as previously described and VDJ and CDR3 annotations were assigned using IMGT/HighV-Quest (IMGT®).
Huang H., Wang C., Rubelt F., Scriba T.J, & Davis M.M. (2020). Analyzing the M. tuberculosis immune response by T cell receptor clustering with GLIPH2 and genome-wide antigen screening. Nature biotechnology, 38(10), 1194-1202.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!