Cas9 nuclease v3
Cas9 Nuclease V3 is a recombinant Cas9 protein from Streptococcus pyogenes. It is a DNA-guided endonuclease that can be programmed with a single guide RNA (sgRNA) to cleave specific DNA sequences.
Lab products found in correlation
6 protocols using cas9 nuclease v3
CRISPR-Mediated Generation of Csb-Deficient Mice
Generation of Inducible SETD2 KO Cell Lines
CRISPR Editing of CD34+ HSPCs
Ribonucleoprotein-based Gene Editing of CD34+ Cells
electroporated with the previously validated EIF2AK1-targeting sgRNAs
TTGTTGGCTATCACACCGCG and ATAGTCGAGAGAAACAAGCG or the nontargeting sgRNAs
GCACTACCAGAGCTAACTCA and GTACGTCGGTATAACTCCTC, together with the Cas9 Nuclease V3 (catalog
number #1081060, Integrated DNA Technologies) using the P3 Primary Cell 4D-Nucleofector X
Kit S (catalog number # V4XP-3032, Lonza). Chemically modified sgRNAs were purchased from
Synthego.
CRISPR-Cas9 Knockout Protocol for BRC6 Cells
CRISPR/Cas9 Genome Editing in Zebrafish Embryos
A 1:1 solution of gRNA and 500 µg/mL of Cas9 nuclease V3 (Integrated DNA Technology) was prepared with phenol red dye (Sigma, P0290). Freshly laid eggs were collected from breeding tanks and the solution was injected in the yolk sac of the egg before the emergence of the first cell with a FemtoJet 4i (Eppendorf).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!