Tgf β1 quantikine elisa

Total RNA was isolated with the ExtractMe total RNA kit (Blirt S.A., Gdańsk, Poland). Reverse transcription was performed with SensiFAST^TM cDNA (Bioline, London, UK). Polymerase chain reaction was done with the SensiFAST™ SYBR ROX Kit (Bioline, Luckenwalde, Germany) on a CFX Connect™ Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA). Primer sequences are hPRG4_F CAGTTGCAGGTGGCATCTC, hPRG4_R TCGTGATTCAGCAAGTTTCATC; hNOX4a_F TCTTGGCTTACCTCCGAGGA, hNOX4a_R CTCCTGGTTCTCCTGCTTGG; hGAPDH_F AAGCCACATCGCTCAGACAC, hGAPDH_R GCCCAATACGACCAAATCC, hID1_F CCAGAACCGCAAGGTGAG, hID1_R GGTCCCTGATGTAGTCGATGA; hID3_F CATCTCCAACGACAAAAGGAG, hID3_R CTTCCGGCAGGAGAGGTT. hCCND1_F TCGGTGTCCTACTTCAAATGTGT; hCCND1_R GGGATGGTCTCCTTCATCTTAG. The IL11 primer was from Bio-Rad (qHsaCEP0049951). The mRNA levels were calculated by normalizing to the housekeeping gene GAPDH using the ΔΔCt method. The amount of TGF-β1 in the aqueous fraction of 1% casein and 1% whey powder was measured by TGF-β1 Quantikine ELISA (#DY240; R&D Systems, Minneapolis, MN, USA). For the IL11 immunoassay, gingival fibroblasts were exposed to 1% of a reconstituted pooled casein and whey powder. After 24 h, the cell culture supernatant was harvested and subjected to the human IL11 Quantikine ELISA testing (#DY218; R&D Systems). ELISA data were not normalized to an internal compound.

TGFβ levels in mouse serum, cerebrospinal fluid (CSF), or tissue lysates were examined using a Mouse/Rat/Porcine/Canine TGFβ1 Quantikine ELISA (R and D Systems). CSF was collected by cisterna magna puncture using 29-gauge needle. Mouse tissues were lysed in 5 mM Tris-HCl (pH 8.0), 150 mM NaCl, 0.02% sodium aside, 0.1% Triton-X, and protease inhibitor (Complete; Roche).