A 5 μL PCR amplicon solution was mixed with loading buffer (Bio-Rad) and then loaded on 8% native PAGE gel to verify and estimate the PCR procedure. A voltage of 110 V was used to drive the electrophoresis. Thereafter, the gel was stained with Ethidium Bromide and imaged using Gel Doc XR + Imager System (Bio-Rad).
Gel doc xr imager system
Manufactured by Bio-Rad
Sourced in United States
The Gel Doc XR+ Imager System is a laboratory equipment used for imaging and analyzing DNA and protein gels. It captures high-quality images of stained gels, which can be used for various applications such as gel documentation, image analysis, and data storage.
Automatically generated - may contain errors
Lab products found in correlation
Gotaq flexi dna polymerase, by Promega (2 mentions)
Loading buffer, by Bio-Rad (1 mentions)
Omniscript rt kit, by Qiagen (1 mentions)
Ab207612, by Abcam (1 mentions)
Ab32028, by Abcam (1 mentions)
Ab32047, by Abcam (1 mentions)
Ab84400, by Abcam (1 mentions)
Ab92552, by Abcam (1 mentions)
R0010, by Solarbio (1 mentions)
Ab192890, by Abcam (1 mentions)
Ab6721, by Abcam (1 mentions)
Ab181604, by Abcam (1 mentions)
Ab32503, by Abcam (1 mentions)
P1200, by Solarbio (1 mentions)
Hvlp04700, by Merck Group (1 mentions)
Ab8227, by Abcam (1 mentions)
Ab32124, by Abcam (1 mentions)
Gotaq long pcr master mix, by Promega (1 mentions)
Wizard genomic dna purification kit, by Promega (1 mentions)
Nucleospin tissue kit, by Macherey-Nagel (1 mentions)
8 protocols using gel doc xr imager system
1
Verifying PCR Amplicon Size
2
Quantitative RT-PCR Analysis of NOX Enzymes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using TRIzol reagent (MRC, Cincinnati, OH, USA) and 1 µg of total RNA was used to synthesize cDNA with an Omniscript RT kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. Then, 2 µl of cDNA was amplified with Solgent Taq (Solgent, Daejeon, Korea) kits in a total volume of 25 µl according to the manufacturer's protocol. The primers for NOX1, NOX2, and NOX4 were synthesized by Integrated DNA Technologies, Inc. (Coralville, IA, USA). PCR products were detected in agarose gels containing 1 µg/ml ethidium bromide. The primer sequences used were as follows. NOX1 forward, 5′-TGGAGTGGCTTGCACC-3′ and reverse, 5′-TGCTGCATGACCAACCTTTT-3′; NOX2 forward, 5′-TTTACACTGACATCCGCCCC-3′ and reverse, 5′-TGGGCCGTCCATACAAAGTC-3′; NOX4 forward, 5′-CGGGCTTCCACTCAGTCTTT-3′ and reverse, 5′-TGATCCGAGGTAAGCCA-3′. PCR conditions were as follows: 95°C for 2 min, followed by 35 cycles, denaturation at 95°C for 30 sec, annealing at 58°C for 30 sec, and extension at 72°C for 45 sec. PCR products were detected in 2% agarose gels containing 1 µg/ml ethidium bromide, and scanned by Gel Doc™ XR+ Imager System (Bio-Rad Laboratories, Inc.). Band intensities of PCR products were quantified using Image J software (version 1.45; National Institutes of Health, Bethesda, MD, USA). The 2−ΔΔCq method was used to calculate the band density (14 (link)).
3
Protein Expression Analysis in Tissue Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
50 mg tissue samples were lysed with protein lysate (R0010; Beijing Solarbio Science & Technology Co., Ltd.) and centrifuged with supernatant collected accordingly. The sampling wells (20 μg/well) were then added to the pre‐treated protein for protein isolation purposes on 10% SDS‐PAGE (P1200, Solarbio). Electrophoresis was initially performed at 8 V/cm, which was turned up to 15 V/cm once the protein had been transferred into the separation gel. The protein samples were subsequently transferred onto polyvinylidene fluoride membranes (HVLP04700, Millipore), which were blocked with 5% skimmed milk for 2 hours, and incubated in a 4°C refrigerator overnight with diluted rabbit anti‐human HNF4A (1:1000, ab181604), AMPK (1:2000, ab32047), mTOR (1:2000, ab32028), LC3‐II (1:2000, ab192890), Beclin‐1 (1:2000, ab207612), Bcl‐2 (1:2000, ab32124), Bax (1:2000, ab32503), phosphorylated (p)‐AMPK (1:2000, ab68206), p‐mTOR (1:2000, ab84400), PCNA (1:2000, ab92552) and β‐actin (1:1000, ab8227) antibody, which were all purchased from Abcam Inc. The samples were incubated with horseradish peroxidase (HRP)‐conjugated goat anti‐rabbit IgG antibody (1:2000, ab6721, Abcam Inc) for 2 hours. DAB was applied for coloration purposes, while the Gel Doc XR imager system (Bio‐Rad Laboratories, Inc CA) was employed for images analyses.
4
Recombinant PA Protein Expression and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To see the recombinant PA expression and purification profile of different clones, SDS PAGE was performed. Briefly, all the seven clones after IPTG induction were harvested and lysed in 2x SDS sample lysis buffer. For purified proteins, 5 μL of each sample was mixed with equal volume of 2x SDS sample lysis buffer before loading onto 10% SDS PAGE. After electrophoresis, the gel was stained with coomassie brilliant blue and image was captured through Gel doc XR+ imager system (Biorad, USA). For western blotting, the soluble cell lysate from all the clones was electrophoresed on 10% SDS PAGE and the gel was transferred to nitrocellulose membrane using TE70XP semidry blot system (Hoefer Inc, USA). Following transfer, the membrane was blocked with 5% skim milk for 1 hour at room temperature and then probed with anti-PA monoclonal antibody at 1 : 1000 dilutions for 1 hour. After washing thrice with PBS-Tween and PBS, the membrane was incubated with anti-mouse IgG-HRP conjugate at 1 : 5000 dilutions and was finally developed with 3,3′-diaminobenzidine tetrahydrochloride (DAB) substrate.
5
PCR-based Genomic DNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from selected clones with the Wizard Genomic DNA Purification Kit (Promega) and PCR amplified with the GoTaq Long PCR master mix (Promega) using the following primers Acox1F: 5'-CTCAAGGCCCTGGCCAATCG -3', Acox1R: 5'-ACGCCCATCGAAGTAGGGGT-3'. To control targeted recombination, PCR products were visualized on a 1% agarose electrophoresis gel using a Bio-Rad Gel Doc XR+ Imager System. NHEJ mediated mutations were confirmed after PCR amplification with the same primers and a GoTaq Flexi DNA polymerase (Promega) (unable to amplify fragments longer than 2 kb), and Sanger sequencing (Eurofins Genomics sanger sequencing platform, Germany).
6
CRISPR/Cas9 Efficiency Assessment via T7 Endonuclease Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from selected clones or cellular pools with the NucleoSpin Tissue Kit (Macherey-Nagel). In order to assess CRISPR/Cas9 efficiency, detection of indels was first performed on a pool of transfected cells with T7 endonuclease assay (GeneCopoeia) from PCR products obtained with the following primers for Abcd1 locus (F: 5′-GGGCACCCCTAACTCGGACTC-3′, R: 5′-GAAAGTGGCAGGAAGGGCGAT-3′), and Abcd2 locus (F: 5′-TTCAAAGGGAAGAGGCCAGGAGT-3′, R: 5′-TCCGAGGCTTCTTTTCCACGATG-3′). After cell sorting, individual screening using PCR with GoTaq Flexi DNA polymerase (Promega) was performed with the following primer pairs:
Abcd2 (F: 5′-TTCAAAGGGAAGAGGCCAGGAGT-3′, R: 5′-AGCTGCATTTAGTCCCGGCG-3′). The 3′ end of each reverse primer was localized at the CRISPR/Cas9 targeted-mutation site. PCR products were visualized with ethidium bromide after electrophoresis on a gel containing 1.5% agarose and using a Bio-Rad Gel Doc XR+ Imager System. NHEJ mediated mutations were confirmed by Sanger sequencing (Eurofins Genomics Sanger sequencing platform, Germany) of PCR products amplified using GoTaq Flexi DNA polymerase (Promega) with the primers used for T7 endonuclease assay.
Abcd2 (F: 5′-TTCAAAGGGAAGAGGCCAGGAGT-3′, R: 5′-AGCTGCATTTAGTCCCGGCG-3′). The 3′ end of each reverse primer was localized at the CRISPR/Cas9 targeted-mutation site. PCR products were visualized with ethidium bromide after electrophoresis on a gel containing 1.5% agarose and using a Bio-Rad Gel Doc XR+ Imager System. NHEJ mediated mutations were confirmed by Sanger sequencing (Eurofins Genomics Sanger sequencing platform, Germany) of PCR products amplified using GoTaq Flexi DNA polymerase (Promega) with the primers used for T7 endonuclease assay.
7
Gene Expression Analysis of Expanded NK Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expanded NK cells were cultured in complete RPMI1640 media (10% FBS, 1% P/S) without IL2 for 48 hours. A total of 2e6 cells were harvested for RNA isolation using the RNeasy Plus Mini Kit (Qiagen). cDNA was obtained from RNA using iScript Reverse Transcription Supermix for qRT-PCR (Bio-Rad). PCR was conducted to amplify regions from the coding sequences of CDK5, p35, p39, and ACTIN. The specific forward and reverse primers used are as follows: CDK5-F: GATGTCGATGACCAGTTGAAGAG; CDK5-R: CGGACAGAAGTCGGAGAAGTA; p35-F: GCTCCTCCTCAGTCAAGAAAG; p35-R: TAGTGTGGGTCGGCATTTATC; p39-F: TGCCCGAGGAGAAGAAGAA; p39-R: CTTGAAAGACCTGCGTGAAGA; Actin-F: GGCACCACACCTTCTACAAT; Actin-R: CCTTAATGTCACGCACGATTTC. PCR products were run on a 2% agarose gel in TAE buffer. A total of 100 bp DNA ladder (New England Biolabs) was used as a reference. The gel was imaged using a Gel Doc XR+ System imager (Bio-Rad).
8
Confirmatory Colony PCR for S. aureus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To confirm the presence of S. aureus , we used colony PCR with femB primers. The primers were FemB1 (5′-CAT GGT TAC GAG CAT CAT GG) and FemB2 (5′-AAC GCC AGA AGC AAG GTT TA), leading to an S. aureus -specific 447-bp PCR product (65 (link)). We touched a pipette tip onto a single S. aureus colony and mixed it with 20 μL of water in a PCR tube. We boiled the samples for 5 min at 95°C. Each sample contained 2 μL of a boiled cell solution and 18 μL of the PCR master mix with MyTaq DNA polymerase (Bioline). The PCR cycling conditions were 95°C 5 min; 30 cycles of 95°C for 15 s, 58°C for 10 s, and 72°C for 30 s; and 72°C for 10 min. We added 2.5 μL Sybr Safe DNA gel stain (Thermo Fisher, UK) to 100 μL of an agarose solution, which contained 1% (wt/vol) agarose dissolved by heating in 1× TBE (Tris-borate-EDTA) buffer. We loaded 15 μL of the PCR mixture into each well, with a 100-bp 5-μL 5 HyperLadder (Bioline) to confirm the product size. Electrophoresis was performed in a Sigma-Aldrich electrophoresis tank with 1× TBE at 100 V for 40 min. Electrophoresed gels were visualized under blue light, and their images were obtained with the GelDoc XR system imager (Bio-Rad).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!