Easyscript cdna synthesis kit

First, TRIzol (Invitrogen) was used to extract total RNA from fresh pancreatic tissue samples and PC cells. Easy Script cDNA Synthesis Kit (TransGen Biotech) was used to reverse transcribed the extracted RNA into complementary DNA (cDNA). Subsequently, the Step One Plus real-time PCR system (Applied Biosystems) and Fast Start Universal SYBR Green Master Mix (Takara) were used for qRT-PCR detection. Table 1 presented the primer sequences used in our manuscript. The relative expression level was analyzed via using 2^−ΔΔCT method.Table 1

Primer list

Gene	Forward primer	Reverse primer
LINC01128	AAGGTGAGGTGAGAGGACAGGAAG	CAAGGCAGGCACTCAACGGTAG
miR-561	CAAAGUUUAAGAUCCUUGAAGU	TCAACTGGTGTCGTGGAGTCGGC
LDHA	GAGTGGAATGAATGTTGCTGGTGTC	CCAGGATGTGTAGCCTTTGAGTTTG
GAPDH	CCAGCCGAGCCACATCGCTC	ATGAGCCCCAGCCTTCTCCAT
U6	CTCGCTTCGGCAGCACATATACT	ACGCTTCACGAATTTGCGTGTC

LINC01128, long intergenic non-protein coding RNA 1128; LDHA, lactate dehydrogenase A; GAPDH, glyceraldehyde 3-phosphate dehydrogenase

TRIzol reagents were used to extract total RNA (Life Technologies, USA). Total RNA cDNA synthesis was carried out according to the manufacturer’s instructions using an EasyScript cDNA Synthesis Kit (Transgene, China). The 2^−ΔΔCt technique was used to measure the expression levels of CCNA2, DBF4, PLK1, CDK2, MMP7, TK1, and 15 additional genes (Table S1). The experiment was at least three times repeated with three technical replicates.

A2058 cells were seeded at 1 × 10⁶ cells per plate in a 60 mm cell culture plate. After overnight incubation, the cells were treated with 0.1% DMSO or 20 µM PCI-34051 for 24 h. A2058 HDAC8 KO and OE cells were seeded at 1 × 10⁶ cells per plate in a 60 mm cell culture plate. Hypoxia was induced using 100 µM CoCl₂ for 6 h or by placing the cells in a hypoxia induction chamber. The total RNA from the cells was extracted using a FavorPrep^TM Blood/Cultured Cell Total RNA Mini Kit (Favorgen Biotech Corporation, Ping-Tung, Taiwan). One microgram of total RNA was reverse-transcribed into cDNA using an EasyScript™ cDNA synthesis kit (TransGen Biotech, Beijing, China). One microliter of cDNA was amplified using 10 µL of TOPreal™ qPCR 2X PreMIX SYBR green reagent (Enzynomics, Daejeon, Republic of Korea). A qPCR analysis was performed using the Applied Biosystems 7500 System (Applied Biosystems, Foster City, CA, USA). The mRNA values were normalized by GAPDH expression levels. The primers used are listed in Table 3.