Irf1 antibody

ChIP assays were performed as previously described (Wu et al, 2017). Glial cells were fixed with 1% formaldehyde for 10 min and quenched with 125 mM glycine. The cells were washed with ice‐cold PBS and lysed with lysis buffer containing various protease inhibitors. The chromatin in the lysates was sonicated into 100–500 bp DNA fragments and was centrifuged to remove the residue. The supernatants were transferred to a new tube and immunoprecipitated by an IgG antibody (negative control) or an IRF1 antibody (Cell Signaling). The immunoprecipitated DNA was extracted with a DNA purification kit and amplified by PCR using the following primer pairs: 5′‐GGTCAAGGTCTCTCACCTGTT‐3′; 5′‐GGGCTTGCTTCCAAGTTGAC‐3′.

RAW264.7 cells were transfected with miR-19a-3p mimics, miR-19a-3p mimics NC, miR-19a-3p inhibitor, and miR-19a-3p iNC for 24 h respectively. After that, the cells were stimulated with LPS and IFN-γ for 24 h. Fixed by 4% paraformaldehyde for 30 min, the cells were infiltrated with 1% Triton X-100 for 10 min, and blocked in 10% normal mice serum for 30 min. After incubation with STAT1 (Cell Signaling Technology) or IRF1 antibody (Cell Signaling Technology) overnight at 4°C, FITC Mouse Anti-Rabbit IgG (BOSTER, Wuhan, China) was incubated for 1 h. The nuclei were counterstained using DAPI, and the sections were observed under fluorescence microscope (IX73, Olympus, Japan).

CUT&RUN was performed on 5 × 10⁵ PH5CH8 cells transfected with CSNK2B versus non-target control siRNAs using CUT&RUN Assay Kit (Cell Signaling Technology, #86652) as per manufacturer's protocol. In brief, trypsinized cells were bound to Concanavalin A beads, permeabilized with digitonin, and incubated with IRF1 antibody (Cell Signaling Technology, #8478, 1:25 dilution) overnight at 4°C on a thermo shaker. On the next day, Protein A-fused micrococcal nuclease was incubated for 30 min at 4°C to bind IRF1 antibody and digest bound sites, followed by incubation at 37°C for 10 min to release digested DNA fragments. DNA was purified using NucleoSpin Gel and PCR Clean-up (MACHEREY-NAGEL) and eluted in 50 μl nuclease-free water.