Anti h3k27me3

Manufactured by Merck Group

Sourced in United States, United Kingdom

Anti-H3K27me3 is a laboratory reagent used for the detection and quantification of the histone H3 lysine 27 trimethylation (H3K27me3) modification in biological samples. It is a specific antibody that binds to the H3K27me3 mark, which is associated with gene repression and chromatin compaction. This product can be used in various applications, such as chromatin immunoprecipitation (ChIP), Western blotting, and immunofluorescence microscopy, to study the epigenetic regulation of gene expression.

Automatically generated - may contain errors

Lab products found in correlation

Anti h3k4me3, by Merck Group (38 mentions) Anti ezh2, by Cell Signaling Technology (17 mentions) Anti h3k27ac, by Abcam (15 mentions) Anti h3k4me1, by Abcam (12 mentions) Anti h3k9ac, by Merck Group (11 mentions) Anti h3k4me3, by Abcam (11 mentions) Anti h3k36me3, by Abcam (11 mentions) Anti flag, by Merck Group (9 mentions) Nextseq 500, by Illumina (8 mentions) Anti h3k9me3, by Merck Group (8 mentions) Anti h3k9me3, by Abcam (8 mentions) Ez chip chromatin immunoprecipitation kit, by Merck Group (8 mentions) Anti h3, by Merck Group (7 mentions) Ab8898, by Abcam (7 mentions) Anti h3k27ac, by Merck Group (7 mentions) Anti ezh2, by Merck Group (6 mentions) Anti h3, by Abcam (6 mentions) Ab8580, by Abcam (6 mentions) Anti h3k4me2, by Merck Group (6 mentions) Anti gfp, by Abcam (6 mentions)

201 protocols using anti h3k27me3

ChIP-Seq protocol for H3K27ac and H3K27me3

Check if the same lab product or an alternative is used in the 5 most similar protocols

For ChIP experiments, NPCs cultured for 7 days in vitro were
harvested and cross-linked for 5 min at room temperature using 1%
formaldehyde. Cells were lysed for by rotating for 10 min at 4 °C in
cell lysis buffer (20mM Tris pH8, 85mM KCl, 0.5% NP-40, protease inhibitor
cocktail). Nuclei were pelleted and re-suspended in nuclei lysis buffer
(50mM Tris pH8, 10mM EDTA, 0.25% SDS, protease inhibitor cocktail).
Chromatin was sheared by Covaris S2 using AFA microtube and a low cell
chromatin shearing protocol for 12 min. Lysates were cleared by
centrifugation at 20,000×g at 4 °C for 5 min and used as IP
inputs. IP was done using MAGnify™ Chromatin Immunoprecipitation
System (Thermo Fisher Scientific) following manufacturer’s protocols.
The antibodies used were as follows: rabbit anti-H3K27ac (Abcam, Cat. #
Ab4729, Lot. # GR312658–1; ChIP validation and peer-reviewed
citations at http://www.abcam.com/histone-h3-acetyl-k27-antibody-chip-gradc-ab4729.html).
rabbit anti-H3K27me3 (Millipore, Cat. # 07–449, Lot. # 2686928; ChIP
validation at http://www.emdmillipore.com/US/en/product/Anti-trimethvl-Histone-H3-Lvs27-Antibodv.MMNF-07– 449 and peer-reviewed citations at https://www.bioz.com/result/antih3k27me3/product/Millipore/?r=4.88&cf=0&uq=Millipore.
Cat. - 07%252D449). Chromatin samples were sent for high throughput
sequencing.

Wang Y., Li Y., Yue M., Wang J., Kumar S., Wechsler-Reya R.J., Zhang Z., Ogawa Y., Kellis M., Duester G, & Zhao J.C. (2018). N6-methyladenosine RNA modification regulates embryonic neural stem cell self-renewal through histone modifications. Nature neuroscience, 21(2), 195-206.

+ Open protocol

+ Expand

Western Blot Analysis of Epigenetic Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Whole cells were lysed in a chilled lysis buffer (150 mM sodium chloride, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, and 50 mM Tris pH 8.0) with protease inhibitor cocktail (Roche, Switzerland). The protein concentration was determined using the Bradford assay. The same amount of protein was resolved by SDS-PAGE. After electrophoresis, the proteins were transferred onto nitrocellulose membranes (BioTrace NT Nitrocellulose membrane; PALL, USA). Then, the membrane was blocked for 1 h at room temperature using 5% skim milk in TBST buffer. The membrane was incubated overnight at 4°C with the following primary antibodies: anti-SETD5 (MBS8245298, 1:1,000; MyBioSource, USA), anti-alpha-tubulin (SC-23948, 1:10,000; Santa Cruz Biotechnology, USA), anti-PARP (9542, 1:1,000; Cell Signaling Technology, USA), anti-H3K27me3 (07-449, 1:1,000; Sigma-Aldrich), anti-H3K4me3 (39159, 1:1,000; Active Motif, Germany), anti-H3K9me2 (39375, 1:1,000; Active Motif), anti-H3K36me3 (ab9050, 1:1,000; Abcam, UK), anti-total H3 (ab1791, 1:1,000; Abcam), anti-phospho-STAT1 (9167, 1:1,000; Cell Signaling Technology), anti-STAT1 (9172, 1:1,000; Cell Signaling Technology), anti-MDA5 (5321, 1:1,000; Cell Signaling Technology), and anti-PKM (ab137791, 1:1,000; Abcam).

Park M., Moon B., Kim J.H., Park S.J., Kim S.K., Park K., Kim J., Kim S.Y., Kim J.H, & Kim J.A. (2022). Downregulation of SETD5 Suppresses the Tumorigenicity of Hepatocellular Carcinoma Cells. Molecules and Cells, 45(8), 550-563.

+ Open protocol

+ Expand

Co-IP and Western Blot of JAK2-Related Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

For Co-IP of endogenous proteins, anti-JAK2 (Millipore, 06-255-I¸1:100), anti-MSH2 (Cell Signaling Technology (CST, MA), 2017S, 1:200), anti-MSH6 (Becton Dickinson (BD, NJ), 610918, 1:100), anti-EZH2 (CST, MA, 5246T, 1:200) antibodies were used. For western blot, anti-JAK2 (Millipore, 06-255-I, 1:1000 and Abcam, CA, ab108596, 1:1000 ), anti-p-JAK2 (Y1007/1008, 1:1000) (Millipore, MA, 07-606), anti-p-STAT3 (Y705) (CST, MA, 9145S, 1:1000), anti-LaminB (Santa Cruz (SC, CA), sc-6216, 1:1000), anti-GAPDH (CST, MA, 5174, 1:1000), anti-MSH2 (CST, MA, 2017S, 1:1000), anti-MSH6 (BD, 610918, 1:1000), anti-DNMT1 (Sigma, MO, D4692, 1:1000), anti-EZH2 (CST, MA, 3147S, 1:1000), anti-STAT3 (CST, MA, 9139, 1:1000), anti-γH2AX (CST, MA, 9718, 1:1000), anti-H3K27me3 (CST, MA, 9733, 1:1000), anti-H3 (CST, MA, 9751, 1:3000), anti-EZH2 (CST, MA, 3147S, 1:1000), anti-SUZ12 (CST, MA, 3737, 1:1000), anti-EED (Sigma, MO, GW10896A, 1:500) antibodies were used. For immunofluorescence, anti-JAK2 (Abcam, CA, ab108596, 1:100), anti-DNMT1 (SC, CA, sc-20701, 1:100), anti-γH2AX (Millipore, NJ, 05-636, 1:100), secondary Alexa Conjugate (CST, MA, mouse 8890, 1:500 and rabbit 8889, 1:1000) were used.

Ding N., Miller S.A., Savant S.S, & O’Hagan H.M. (2019). JAK2 regulates mismatch repair protein-mediated epigenetic alterations in response to oxidative damage. Environmental and molecular mutagenesis, 60(4), 308-319.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation with Spike-in Controls

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lysates of crosslinked cells were sonicated in lysis buffer (10 mM Tris-HCl pH8.1, 150 mM NaCl, 5 mM EDTA, 0.5% Sarkosyl, 0.1% sodium deoxycholate, complete protease inhibitor cocktail, 1 mM NaF, 0.1 mM Na₃VO₄, and 10 mM glycerophosphate) using a Bioruptor Plus (12 cycles of 30s on/off, high power) to obtain DNA fragment averaging 500–700 bp. Soluble chromatin fraction was diluted 1:5 (10 mM Tris-HCl pH8.1, 5 mM EDTA, 150 mM NaCl, 1% Triton X-100, complete protease inhibitor cocktail, 1 mM NaF, 0.1 mM Na₃VO₄, and 10 mM glycerophosphate) with the addition of 40 ng Spike-in Chromatin per reaction (Active Motif 53083). Immunoprecipitation was conducted using 4 μg of anti-H3 (Abcam ab1791), 4 μg anti-H3K27me3 (Sigma-Aldrich 07–449), 4 μg anti-H3K4me3 (Sigma-Aldrich 07–473), 4 μg control IgG (Sigma-Aldrich 12–370), 2 μg Spike-in Antibody (AB_2737370) and 900 μg of chromatin at 4°C for 16 h. Immunoprecipitates were incubated with 35 μl of Dynabeads Protein G for 2 h, washed 2x with Low-salt wash buffer (20 mM Tris-HCl pH 8.1, 2 mM EDTA, 200 mM NaCl, 1% Triton X-100), 2x in LiCl buffer (10 mM Tris-HCl pH8.1, 2 mM EDTA, 1% NP40, 250 mM LiCl), and 1x in TE. Chromatin was eluted and purified as in the IRF4 ChIP experiments. Primers were designed according to (Liang et al., 2013 ) (GAPDH) and (Cao et al., 2014 (link)) (MYT1). All primer sequences are indicated in Table S7.

Dersh D., Phelan J.D., Gumina M.E., Wang B., Arbuckle J.H., Holly J., Kishton R.J., Markowitz T.E., Seedhom M.O., Fridlyand N., Wright G.W., Huang D.W., Ceribelli M., Thomas C.J., Lack J.B., Restifo N.P., Kristie T.M., Staudt L.M, & Yewdell J.W. (2020). Genome-wide Screens Identify Lineage- and Tumor-Specific Genes Modulating MHC-I- and MHC-II-Restricted Immunosurveillance of Human Lymphomas. Immunity, 54(1), 116-131.e10.

+ Open protocol

+ Expand

HiChIP Profiling of Histone Modifications

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

HiChIP experiments were performed on shoots and roots of 14-d-old seedlings using the same procedure as in Concia et al. (2020) (link) with either anti-H3K9ac (MilliporeSigma 07–352) or anti-H3K27me3 (Sigma-Aldrich 07–449). The quality of the libraries was assessed with Agilent 2100 Bioanalyzer (Agilent), and the libraries were subjected to 2 × 75 bp paired-end high-throughput sequencing by NextSeq 500 (Illumina).

Huang Y., Sicar S., Ramirez-Prado J.S., Manza-Mianza D., Antunez-Sanchez J., Brik-Chaouche R., Rodriguez-Granados N.Y., An J., Bergounioux C., Mahfouz M.M., Hirt H., Crespi M., Concia L., Barneche F., Amiard S., Probst A.V., Gutierrez-Marcos J., Ariel F., Raynaud C., Latrasse D, & Benhamed M. (2021). Polycomb-dependent differential chromatin compartmentalization determines gene coregulation in Arabidopsis. Genome Research, 31(7), 1230-1244.

+ Open protocol

+ Expand

Quantitative Proteome Analysis of NRVM Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total proteins were extracted from NRVM cells. NRVM cells lysed in Radio Immunoprecipitation Assay (RIPA) lysis buffers (Beyotime, Nanjing, China). Cell lysates were centrifuged at 12,000 × g for 15 min. The proteins concentration was detected by the BCA method, and equal quantities of protein extracts were loaded on a sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), then transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore Corp., Bedford, MA, U.S.A.). The membranes were blocked with 5% (w/v) non-fat milk for 1 h at room temperature, the membranes were incubated with specific primary antibodies overnight at 4°C. After washing 3 times with TBST, the membranes were incubated with the HRP-linked secondary antibody at room temperature for 1 h, and then washed 3 times with TBST again. Finally, the protein bands on the membranes were detected by chemiluminescent reagents (Beyotime, Nanjing, China). Chemiluminescence signals were quantified using an ECL imager, and analyzed using Quantity One software (Bio-Rad, Hercules, CA, USA). The specific primary antibodies were: anti-GAPDH (Proteintech), anti-Histone3 (Proteintech), anti-H3K4me3 (CST), anti-H3K9me3 (CST), anti-H3K27me3 (CST), anti-H3K36me3 (CST), anti-Flag (Sigma), and anti-Puromycin (Santa Cruz).

Guo N., Zheng D., Sun J., Lv J., Wang S., Fang Y., Zhao Z., Zeng S., Guo Q., Tong J, & Wang Z. (2021). NAP1L5 Promotes Nucleolar Hypertrophy and Is Required for Translation Activation During Cardiomyocyte Hypertrophy. Frontiers in Cardiovascular Medicine, 8, 791501.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation Sequencing of Epigenetic Marks

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Micro-dissected GT (35 to 40) or CR (70) were crosslinked in 1% formaldehyde/PBS for 20 min and stored at −80°C until further processing. Chromatin was sheared using a water-bath sonicator (Covaris E220 evolution ultra-sonicator). Immunoprecipitation was done using the following antibodies, anti-CTCF (Active Motif, 61311), anti- H3K27ac (Abcam, ab4729), and anti-H3K27me3 (Merck Millipore, 07–449). Libraries were prepared using the TruSeq protocol, and sequenced on the Illumina HiSeq system (100 bp single-end reads) according to manufactures instructions.
ChIP-seq reads processing was done on the Duboule local Galaxy server (Afgan et al., 2016 (link)). Adapters and bad-quality bases were removed with Cutadapt version 1.16 (Martin, 2011 (link)) (options -m 15 -q 30 -a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC). Reads were mapped to the mouse genome (mm10) using Bowtie2 (v2.3.4.1) (Langmead and Salzberg, 2012 (link)), with standard settings. The coverage was obtained as the output of MACS2 (v2.1.1.20160309) (Zhang et al., 2008 (link)). Peak calling in Figure 5 was done using MACS2 (v2.1.0.20160309) callpeak (--gsize 1870000000) using the corresponding input data as control BAM (-c). CTCF motif orientation was assessed using the CTCFBSDB 2.0 database (Ziebarth et al., 2013 (link)), with EMBL_M1 identified motifs.

Amândio A.R., Lopez-Delisle L., Bolt C.C., Mascrez B, & Duboule D. (2020). A complex regulatory landscape involved in the development of mammalian external genitals. eLife, 9, e52962.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation (ChIP) Assay

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Chromatin immunoprecipitation (ChIP) was performed as previously described (35 (link), 74 (link)). All ChIP-seq assays were performed using single donors in triplicate. For quantitative ChIP-seq experiments, 4 × 10⁶ SF9 cells were spiked into the pool. The cells were treated with formaldehyde to cross-link, and chromatin was fragmented to 200 to 300 bp, using a Biorupter Pico sonicator (Diagenode). Each lysate was immunoprecipitated with 10 μg of anti-H3K4me3 (Merck Millipore) and anti-H3K27me3 (Merck Millipore) antibodies. The chromatin immunoprecipitation (ChIP) experiment was then performed for each antibody as described previously by Orlando et al. (74 (link)). Library preparation was performed using a NEBNext Ultra DNA sample preparation kit (NEB), according to the manufacturer’s recommendations. The samples were multiplexed, quantified using a High-sensitivity d1000 TapeStation (Agilent) or a Kapa library quantification kit (KAPA Biosystems), and then sequenced using a NextSeq 500 (Illumina) (paired-end, 2 × 41 bp). Sequencing depth was >20 million reads per sample.

Cribbs A.P., Terlecki-Zaniewicz S., Philpott M., Baardman J., Ahern D., Lindow M., Obad S., Oerum H., Sampey B., Mander P.K., Penn H., Wordsworth P., Bowness P., de Winther M., Prinjha R.K., Feldmann M, & Oppermann U. (2020). Histone H3K27me3 demethylases regulate human Th17 cell development and effector functions by impacting on metabolism. Proceedings of the National Academy of Sciences of the United States of America, 117(11), 6056-6066.

+ Open protocol

+ Expand

Western Blotting of PRC2 Protein Complex

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human tissues for Western blotting were lysed in RIPA (50 mM Tris pH 7.4, 1% NP40, 150 mM NaCl, 40 mM NaF, 1 mM Na₃VO₄, 1 mM EDTA and 10 μl/ml of protease inhibitor cocktail) buffer. For cell lines, the cells were seeded in dishes at 60% confluence overnight and then treated with emodin or vehicle control for 24 h. The cells were lysed in ice-cold RIPA buffer according to previously described methods [56 (link)]. Protein concentrations were quantified using a BCA assay (Thermo Scientific Pierce) according to the manufacturer's protocol. Lysate 5-40 μg was loaded into each lane by Western blotting. The specific signal was detected using a secondary antibody coupled with horseradish peroxidase (Jackson ImmunoResearch Labs) and Chemilucent Plus Western Blot Enhancing Kit (Millipore, Bedford, MA, USA).
The antibodies used included anti-EZH2 (Clone: AC-22, CellSignaling, Danvers, MA, USA), anti-Actin (Sigma, St Louis, MI, USA), anti-V5 tag (AbD Serotec, USA), anti-H3K27me3 (Merck-Millipore, Upstate, Lake Placid, NY, USA), anti-EED (Abcam, Cambridge, UK), anti-Suz12 (CellSignaling, Danvers, MA, USA), anti-HA (Clone:12CA5, Roche), and anti-GAPDH (Sigma, St Louis, MI, USA). Secondary antibodies, including goat-anti-mouse-HRP and goat-anti-rabbit-HRP, were purchased from Jackson ImmunoResearch Labs (Westgrove, CA, USA).

Tang S.H., Huang H.S., Wu H.U., Tsai Y.T., Chuang M.J., Yu C.P., Huang S.M., Sun G.H., Chang S.Y., Hsiao P.W., Yu D.S, & Cha T.L. (2014). Pharmacologic down-regulation of EZH2 suppresses bladder cancer in vitro and in vivo. Oncotarget, 5(21), 10342-10355.

+ Open protocol

+ Expand

Sequential ChIP-qPCR Analysis of Neuronal Epigenome

Check if the same lab product or an alternative is used in the 5 most similar protocols

Around 16 million of FACS purified neurons at E15.5 were collected, fixed and fragmented as described in ChIP-seq. The sequential ChIP experiment was performed using a Re-ChIP-IT kit (Active Motif). Anti-Pol II-Ser5P (ab5131, Abcam) or anti-H3K27me3 (07-449, EMD Millipore) was used in the first immunoprecipitation, respectively. Then anti-H3K27me3 or Anti-Pol II-Ser5P was added to precipitated chromatin in the second reaction. For control, a ChIP grade IgG (Abcam) was used replacing Anti-Pol II-Ser5P or anti-H3K27me3 in the second reactions. DNAs eluted from the second immunoprecipitations were applied to real-time quantitative PCR analysis using a DyNAmo flash SYBR green qPCR kit (Thermo Fisher) on a StepOnePlus real-time PCR system (Applied Biosystems).

Liu J., Wu X., Zhang H., Pfeifer G.P, & Lu Q. (2017). Dynamics of RNA polymerase II pausing and bivalent histone H3 methylation during neuronal differentiation in brain development. Cell reports, 20(6), 1307-1318.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!