Total RNA was extracted by Trizol. After precipitation with chloroform, isopropanol, and 75% ethanol, total RNA was dissolved in 40 μL of DEPC water. The RNA was reverse-transcribed into cDNA using a reverse transcription kit (TaKaRa, Dalian, China), and the prepared cDNA was amplified using the SYBR Green PCR kit (KM4101, KAPA Biosystems, USA). The amplification system was as follows: 10 μL of SYBR Green Mix, 5 mol of forward primer, 5 mol of reverse primer, 1 μL of cDNA, and 8 μL of double-distilled water for a total of 20 μL. Reaction procedure is as follows: 95°C for 3 min; 39 cycles of 95°C for 5 s, 56°C for 10 s, 72°C for 25 s; 65°C for 5 s; 95°C for 50 s. The primers were EPHA2-forward (5′-CTGCTCGCCTGGATT-3′), EPHA2-reverse (5′-ACGGCTGTGAGGTAGTG-3′), GAPDH-forward (5′-CCACTCCTCCACCTTTG-3′), and GAPDH-reverse (5′-CACCACCCTGTTGCTGT-3′).
Sybr green pcr kit
Manufactured by Roche
Sourced in United States, Switzerland, Germany, China
The SYBR Green PCR kit is a reagent system designed for real-time quantitative PCR (qPCR) analysis. The kit contains the necessary components, including SYBR Green I dye, for the amplification and detection of DNA sequences. The SYBR Green I dye binds to double-stranded DNA, allowing for the monitoring of the PCR amplification process in real-time.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (68 mentions)
Trizol, by Thermo Fisher Scientific (27 mentions)
Primescript rt reagent kit, by Takara Bio (18 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (17 mentions)
Primescript rt master mix, by Takara Bio (11 mentions)
Trizol reagent, by Takara Bio (11 mentions)
Primescript rt kit, by Takara Bio (8 mentions)
Reverse transcription kit, by Takara Bio (7 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (7 mentions)
Reverse transcriptase kit, by Takara Bio (6 mentions)
Real time system, by Bio-Rad (6 mentions)
Lightcycler 480 real time pcr system, by Roche (6 mentions)
Primerscript rt pcr kit, by Takara Bio (6 mentions)
Primescript rt pcr kit, by Takara Bio (6 mentions)
Reverse transcriptase cdna synthesis kit, by Toyobo (5 mentions)
Lightcycler 480, by Roche (5 mentions)
Amv reverse transcriptase, by Takara Bio (5 mentions)
Dnase 1, by Thermo Fisher Scientific (4 mentions)
Reverse transcription kit, by Thermo Fisher Scientific (4 mentions)
Goscript reverse transcription system, by Promega (4 mentions)
175 protocols using sybr green pcr kit
1
Quantifying EPHA2 gene expression
2
Anticoagulant and Antiplatelet Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Aspirin Enteric-coated Tablets (J20130078) was produced by Bayer Healthcare S.r.l. (Leverkusen, Germany) and dissolved in 0.5% CMC-Na to 3 mg/mL before using. Fufang Danshen Tablets (Z44022225) was bought from Guangdong Yili Group Pharmaceutical Holding Co., Ltd. (Sihui, China) and dissolved in 0.5% CMC-Na before using. Adrenaline Hydrochloride injection (H12020526) was manufactured by Tianjin Jinyao Pharmaceutical Co., Ltd. (Tianjin, China). activated partial thromboplastin time assay kit (F008-2), prothrombin time assay kit (F002), thrombin time assay kit (F009), fibrinogen (FIB) assay kit (F010), von Willebrand factor (vWF) ELISA kit (H274), and thrombomodulin (TM) ELISA kit (H273) were bought from Nanjing Jian Cheng Bioengineering Institute (Nanjing, China). TXB2 ELISA kit (ADI-900-002) and 6-keto-PGF1α ELISA kit (ADI-900-004) were purchased from Enzo Life Sciences Inc. (New York, USA). Trizol reagent (15596026) was purchased from Invitrogen (Carlsbad, CA, USA). DEPC-water (PAB180005) was purchased from Bio-Swamp Life Science Lab (Wuhan, Hubei). DNase I (2270A) and reverse transcription kit (639505) were purchased from Takara Biomedical Technology (Beijing) Co., Ltd. (Beijing, China). SYBR green PCR kit (KM4101) was purchased from KAPA Biosystems (Boston, MA, USA). All of the other chemicals were of analytical-reagent grade.
3
Analysis of Inflammatory Cytokines in BV-2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the BV-2 cells using the TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer's protocol. 1 mg of RNA was reverse-transcribed to cDNA using a PrimeScript™ RT reagent kit (TaKaRa Bio Inc., Beijing, China). Quantitative RT-PCR analysis was performed using a SYBR Green PCR Kit (KAPA Biosystems, South Africa) with 1 μL of cDNA template in 20 μL reaction mixture. Results were analyzed using the comparative CT method. Data are expressed throughout the study as 2−ΔΔCT for the experimental gene of interest normalized to β-actin. The gene-specific primer pairs were as follows: mouse REST gene forward 5′-GGCAGATGGCCGAATTGATG-3′ and reverse 5′-CTTTGAGGTCAGCCGACTCT-3′, actin gene forward 5′-ATCATGTTTGAGACCTTAAA-3′ and reverse 5′-CATCTCTTGCTCGAAGTCCA-3′, TNF-α gene forward 5′-CCTCTCTCTAATCAGCCCTCTG-3′ and reverse 5′-GAGGACCTGGGAGTAGATGAG-3′, IL-1β gene forward 5′-CCAGGGACAGGATATGGAGCA-3′ and reverse 5′-TTCAACACGCAGGACAGGTACG-3′, and IL-6 gene forward 5′-AAGCCAGA GCTGTGCAGATGAGTA-3′ and reverse 5′-TGTCCTGCAG CCACTGGTTC-3′.
4
Quantitative Analysis of miRNA and mRNA Expression in VSMCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from VSMCs using TRIzol reagent (15,596,026; Ambion; Thermo Fisher Scientific, USA) and reverse-transcribed to first-strand cDNA using a reverse transcription kit (6215 A; TaKaRa Biotechnology Co., Ltd., Dalian, China). The cDNA was subsequently subjected to PCR amplification using a SYBR Green PCR Kit (KM4101; KAPA Biosystems; Boston, USA), with the amplification products being analyzed using the 2−ΔΔCq method. The sequences of the primers used for amplification are shown in Table 1 .
The sequences of primers used for quantitative real-time polymerase chain reaction
| Gene name | Primer sequences |
|---|---|
| miR-195-5p | F: GGGGTAGCAGCACAGAAAT |
| R: CTGGTGTCGTGGAGTCGG | |
| U6 (internal reference of miRNA) | F: CTCGCTTCGGCAGCACA |
| R: AACGCTTCACGAATTTGCGT | |
| Runt | F: CGGGCAATGACGAAAAC |
| R: GCTCGGAAAAGGACAAACT | |
| RUNX2 | F: GGACGAGGCAAGAGTTTCAC |
| R: ACTGGGATGAGGAATGCG | |
| bone morphogenetic protein (BMP) 2 | F: CGAGAAAAGCGTCAAGCC |
| R: CCACATCACTGAAGTCCACATAC | |
| alkaline phosphatase (ALP) | F: GGTGTCGGAAGATGGGA |
| R: CAAAGGAATGTTAGGGGC | |
| osteocalcin (OCN) | F: GGAGGGCAGTAAGGTGGTGAA |
| R: GAAGCCAATGTGGTCCGCTA | |
| Smad7 | F: GTGCGTGGTGGCATACTGG |
| R: CGATCTTGCTCCTCACTTTCTG | |
| GAPDH (internal reference of mRNA) | F: CCACTCCTCCACCTTTG |
| R: CACCACCCTGTTGCTGT |
5
Comprehensive Immune Cell Profiling Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PerCP Mouse Anti-Human CD4 (Cat# 347324), FITC Mouse Anti-Human CD25 (Cat#555431), PE Mouse anti-Human Foxp 3 (Cat# 560852), PE Mouse anti-Human IL-17A (Cat# 560486), Permeabilizing Solution 2 (Cat# 340973), Lysing Solution (10X) (Cat# 349202), and Protein Transport Inhibitor (Cat# 51-2092KZ) were purchased from BD Biosciences, USA. Red Blood Cell Lysis Buffer (Cat# 420301) was obtained from Biolegend, Inc. TRIzol solution (Cat# 15596026) was purchased from Ambon, USA. SYBR Green PCR kit (Cat# KM4101) and cDNA first strand synthesis kit (Cat# 639505) were provided by KAPA Biosystems, USA and Takara Bio, Japan respectively. DNase I (Cat# AM2295) was obtained from Fermentas, Lithuania. PCR primers were synthesized by Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. All other reagents were of the highest quality available from commercial vendors.
6
Quantitative Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissue or cell samples were homogenized with 1 mL of TRIzol reagent for RNA extraction. Reverse transcription using the Advantage® RT-for-PCR Kit (Takara, Kyoto, Japan), and qRT-PCR was performed using the SYBR Green PCR kit (KAPA Biosystems, Wilmington, MA) on a CFX-Connect 96 system (Bio-Rad, Hercules, CA). The mRNA primers are shown in Table 1 . The data were analyzed using the 2-ΔΔCt method. Reaction conditions were as follows: initial denaturation at 95 °C for 3 min; 39 cycles of denaturation at 95 °C for 5 s, annealing at 56 °C for 10 s, and extension at 72 °C for 25 s; and final extension at 65 °C for 5 s and 95 °C for 50 s.
7
Quantitative RT-PCR for ErbB2 and Nkx2-5 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using TRIzol (15596026, Ambion, Inc., Foster City, CA, USA) and reverse-transcribed into cDNA using the RevertAid First Strand cDNA Synthesis Kit (K1622, Thermo Scientific) and TaqMan microRNA assay kit (Applied Biosystems, Foster City, CA, USA). qRT-PCR was performed using the SYBR Green PCR Kit (KM4101, KAPA Biosystems, Wilmington, MA) with the following primer sequences: ErbB2 forward 5′-ACCCGCTGAACAATACCA-3′ and reverse 5′-GGATCAAGACCCCTCCTT-3′; Nkx2-5 forward 5′-TGTGCGTCTGCCTTTCCC-3′ and reverse 5′-GCGTTGTCCGCCTCTGTC-3′; and GAPDH forward 5′-CCACTCCTCCACCTTTG-3′ and reverse 5′-CACCACCCTGTTGCTGT-3′. The experimental conditions were as follows: initial denaturation at 95°C for 3 min; 39 cycles of denaturation at 95°C for 5 s, annealing at 56°C for 10 s, and extension at 72°C for 25 s; and final extension at 65°C for 5 s and 95°C for 50 s. Data acquisition was carried out using the QuantStudio™ 6 Flex Real-Time PCR System (Applied Biosystems) and analyzed with the 2-ΔΔCt method [19 (link)].
8
Quantitative Analysis of miRNA and lncRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In a homogenization tube, 1 × 106 cells of CCRF-CEM and HL-60 cells and 1 mL of TRIzol were mixed. The mixture was homogenized with a homogenizer for 20 seconds and then immediately placed on ice for total RNA extraction and reverse transcription. The SYBR Green PCR kit (KM4101; KAPA Biosystems) was used for qRT-PCR amplification. The reaction procedure is as follows: initial denaturation at 95°C for 3 minutes, denaturation at 95°C for 5 seconds, denaturation at 95°C for 5 seconds, annealing at 56°C for 10 seconds, extension at 72°C for 25 seconds (40 cycles), extension at 65°C for 5 seconds, and extension at 95°C for 50 seconds. Data were analyzed using the 2-ΔΔCt method. The primer sequences used were as follows: miR-135a-5p–F: GGGGTATGGCTTTTTATTCCT, miR-135a-5p–R: AACTGGTGTCGTGGAGTCGGC; LINCOO599-F: AGGAAGTCGTTGGGCTATGT, LINCOO599-R: CTACAGGGAGGGCGTGAG; U6-F: CTCGCTTCGGCAGCACA, U6-R: AACGCTTCACGAATTTGCGT; GAPDH-F: CCTTCCGTGTTCCTAC, GAPDH-R: GACAACCTGGTCCTCA.
9
Gene Expression Analysis by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were extracted using Trizol reagent according to the manufacturer's procedures; cDNA was synthesized using a reverse transcriptase kit (TAKARA, Osaka, Japan). qPCR was performed with a real-time system (BIO-RAD, CA, USA) using the SYBR Green PCR Kit (KM4101, KAPA Biosystems, Massachusetts, USA). Each qPCR reaction (95°C, 3 min for denaturation; 95°C, 5 s and 56°C, 10 s and 72°C, 25 s for 39 cycles; 65°C, 5 s and 95°C, 50 s) was performed in duplicate. The results were analyzed by the 2-△△Ct method. The primers were designed and configured by Nanjing Kingsy Biotechnology Co., Ltd. and were listed in Table 1 .
10
Quantifying mTOR Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using TRIzol (15596026, Ambion, Inc., Foster City, CA) and reverse-transcribed into cDNA using the PrimeScript II RTase kit (Takara, Kyoto, Japan). qRT-PCR was performed using the SYBR Green PCR kit (KM4101, KAPA Biosystems, Wilmington, MA) on a CFX Connect 96 apparatus (Bio-Rad, Hercules, CA) with the following primer sequences: mTOR forward, 5′-CGGTGTTGCAGAGACTTGATGGAG-3′ and reverse, 5′-CTGTGAAGGCAGAAGGTCGGAATG-3′; GAPDH forward, 5′-CCACTCCTCCACCTTTG-3′ and reverse, 5′-CACCACCCTGTTGCTGT-3′. The experimental conditions were as follows: initial denaturation at 95 °C for 3 min; 39 cycles of denaturation at 95 °C for 5 s, annealing at 56 °C for 10 s, and extension at 72 °C for 25 s; and final extension at 65 °C for 5 s and 95 °C for 50 s. Relative fold change in mRNA expression was analyzed with the 2−ΔΔCt method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!