Mmulv

CD4⁺ T cells were purified from PBMC using magnetic cell isolation beads according to the manufacturer’s instructions (MACS, Miltenyi Biotech). CD4⁺ T cell purity was >98% by flow cytometry. RNA was extracted from the isolated CD4⁺ T cells using an RNA isolation kit (RNeasy Mini Kit, Qiagen). mRNA levels of transcription factors (TBET, GATA3, RORC, PRDM1), cytokines (IFNG, IL10, IL17A, IL21) and CD40L were determined semi-quantitatively using real-time polymerase chain reaction (RT-PCR) with Sybr Green. RNA was reverse transcribed using Moloney Murine Leukemia virus reverse transcriptase (M-MuLV, Fermentas) with random hexamer primers (Roche) and the obtained cDNA was used for the quantification of mRNA levels. The PCR reactions were optimized with specific primer sets and performed on the LightCycler (FastStart DNA Master SYBR Green I, Roche Light Cycler 480 II) (S1 Table). Relative quantification of target genes was performed by 2^–ΔΔCT method using the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as the reference gene.

Equal amounts (2 μg) of total mRNA from formononetin and everolimus-treated cells were subsequently transcribed into cDNA using M-MuLV reverse transcriptase (Thermo Fisher Scientific) (Waltham, MA, USA). All reactions were performed in a final volume of 20 μL. The qRT-PCR reaction conditions were as follows: activation at 95°C for 10 min with 40 cycles of denaturation at 95°C for 15 s, primer annealing and extension at 60°C for 1 min, and ramping back to 95°C. Human-specific primers for 5′-GCAATATGTTCATAACGATGGCTGTGG-3′ (PTEN forward) and 5′-GAACTGGCAGGTAGAAGGCAACTC-3′ (PTEN reverse), 5′-TTGGAGAACCAGCCCATAAGA-3′ (mTOR forward) and 5′-ATGAGATGTCGCTTGCTTGATAA-3′ (mTOR reverse), 5′-CGCCTGCCCTTCTACAACC-3′ (Akt forward) and 5′-TCATACACATCTTGCCACACGA-3′ (Akt reverse), 5′-GGGCTAGCGATGTCCGGGGGCAGCAGCTG-3′ (4EBP1 forward) and 5′-GGAAGCTTAATGTCCATCTCAAACTGTGACTC-3′ (4EBP1 reverse), 5′-GGGCTAGCGATGAGGCGACGAAGGAGGCGG-3′ (p70s6k forward) and 5′-GGGGTACCTAGATTCATACGCAGGTGCTCTG-3′ (p70s6k reverse) were designed. Expression was assessed using the ΔCt method.

Total RNA was isolated from mice hippocampus 7 h after pilocarpine injection using Trizol reagent (Invitrogen Life Technologies), and reverse transcribed using MMulV (Thermo Scientific). Rqf-PCR was performed as previously described [23 (link)]. PCR primers were designed to amplify 8a exon region: Ex8_FW: 6-Fam-5′TCCCATGGCTGTCGTCAGCA3’; Ex11_RV:5′CTACCATTTCATCTTTTTCTTTTGG3′. The ratio of neuroLSD1/LSD1 was analyzed by peak scanner software v.1.0.

Total RNA was isolated with Total RNA Isolation Reagent according to the manufacturer's protocol (Thermo Scientific). 2 μg RNA was transcribed using 125 units MMuLv (Thermo Scientific). Quantitative real–time PCR reagents were from Thermo Scientific and real-time PCR was performed using the Mx3000 (Stratagene) detection system. Expression differences were calculated as described before [37 (link)].

Total RNA was isolated from mice hippocampus 7- or 24- hours after pilocarpine injection using Trizol reagent (Invitrogen Life Technologies) and reverse transcribed using MMulV (Thermo Scientific). Primers were based on the coding frame of the mouse rcor1 gene: F: 5′TCAGCAGACCACATCGTCAC3'; R:5′CATGAGGCTACAGTGCCCAA3'; rcor2 gene:F:5′AGGACAGAAGGGACTAGGGC3′; R:5′GTCACAGCCAGGAAGCAAGA3′; rcor3 gene: F:5′CACGGGGATGTTGGGATGAG3′ R:5′CGTGAAGTTAGGGAGGTCCG3'. Primers were manufactured by IDT™. All PCRs were performed with 5 x HOT FIREPol® EvaGreen® qPCR Mix Plus (Solis BioDyne) using a LightCycler 2 (Roche).

Total RNA was isolated with Total RNA Isolation Reagent (Thermo Scientific). 1 μg RNA was transcribed using 125 units MMuLv (Thermo Scientific). Quantitative real–time PCR reagents were from Thermo Scientific and real-time PCR was performed using the Mx3000 (Stratagene) detection system. Expression differences were calculated as described before. Primer sequences are listed in Supplementary Table 1.

Total RNA was isolated from HT22 using Trizol reagent (Invitrogen Life Technologies), and reverse transcribed using MMulV (Thermo Scientific). Rqf-PCR was performed as previously described^{67 (link)}. qPCR primers were designed to amplify 8a exon region: Ex8_FW: 6-Fam-5′TCCCATGGCTGTCGTCAGCA3′; Ex11_RV:5′CTACCATTTCATCTTTTTCTTTTGG3′. The ratio of uLSD1/nLSD1 was analyzed by peak scanner software v.1.0.