A previously reported method was used for the total protein extraction of Caco-2 monolayers [21 (link)]. In vivo, the total protein of the mucosa (2 cm) in the proximal colon was extracted using a method described previously with some modifications [14 (link), 22 (link)]. The concentration of proteins was measured using bicinchoninic acid (BCA) method (Thermo Fisher Scientific, Waltham, MA, USA). Subsequently, the electrophoresis of extracts involving equivalent quantities of proteins (25 μg) was conducted in 6% or 10% polyacrylamide gel, and then various proteins were transferred to polyvinylidene difluoride (PVDF) membranes. At room temperature, the membrane was blocked for nonspecific binding for 1 h (5% bovine serum albumin (BSA) in TBS-Tween 20 buffer) and then incubated overnight at 4°C with primary antibodies (1 : 1000 dilution). Subsequently, with the corresponding secondary antibodies (1 : 1000 dilution), the membrane was incubated at room temperature for 1 h. Finally, blots were developed with electrochemiluminescence (ECL) detection reagents (Merck Millipore, Burlington, MA, USA) and visualized by Syngene GeneGenius gel imaging system (Syngene, Frederick, MD).
Genegenius
Manufactured by Syngene
Sourced in United Kingdom, United States
The GeneGenius is a gel documentation and analysis system designed for imaging and analyzing nucleic acid and protein samples. It provides high-quality imaging and analysis capabilities for various applications, including DNA, RNA, and protein gel electrophoresis, as well as chemiluminescence and fluorescence detection.
Automatically generated - may contain errors
Lab products found in correlation
T100 thermocycler, by Bio-Rad (2 mentions)
Cell lysis buffer system, by Santa Cruz Biotechnology (2 mentions)
Bcl 2, by Abcam (2 mentions)
Gapdh, by Abcam (2 mentions)
Kgp250 kgp2100, by Keygen Biotech (2 mentions)
Ecl detection reagent, by Merck Group (1 mentions)
Tianamp genomic dna kit, by Tiangen Biotech (1 mentions)
Methylation specific pcr kit, by Tiangen Biotech (1 mentions)
Relaxgene blood dna system, by Tiangen Biotech (1 mentions)
Dna bisulfite conversion kit, by Tiangen Biotech (1 mentions)
α sma, by Merck Group (1 mentions)
Caspase 3, by Proteintech (1 mentions)
Gapdh, by Proteintech (1 mentions)
Cyclin b1, by Proteintech (1 mentions)
Bcl2 associated x (bax), by Proteintech (1 mentions)
Cyclin d1, by Proteintech (1 mentions)
Nf κb p65, by Proteintech (1 mentions)
High fidelity pcr enzyme mix, by Thermo Fisher Scientific (1 mentions)
Erk1 2, by Cell Signaling Technology (1 mentions)
P38 mapk, by Cell Signaling Technology (1 mentions)
28 protocols using genegenius
1
Total Protein Extraction and Analysis
2
Methylation Analysis of NOTCH2NLC Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Methylation-specific PCR (MSP) was used to investigate the CpG methylation status of
promoter region of expanded GGC repeats in the 5′ UTR of NOTCH2NLC gene.
RelaxGene Blood DNA System (Tiangen, DP349) and TIANamp Genomic DNA Kit (Tiangen, DP304)
were used to extract genomic DNA from blood and skeletal muscle samples, respectively. DNA
was converted using the DNA Bisulfite Conversion Kit (Tiangen, DP205). MSP was performed
using the methylation-specific PCR Kit (Tiangen, Em101) with the following primers:
methylation–specific-F: 5′-GAGGATCGTTTTTTTTTGTAAGTTTACGATTTC-3′; methylation-specific-R:
5′-AATCTACTACGAATCACTAACCCCG-3′; unmethylation-specific-F:
5′-GGATGAGGATTGTTTTTTTTTGTAAGTTTATGATTTT-3′; unmethylation-specific-R:
5′-CAAAAAAATCTACTACAAATCACTAACCCCA-3′. PCR conditions were as follows: 95°C for 5 min,
followed by 35 cycles of 94°C for 20 s, 60°C for 30 s and 72°C for 20 s, and then 72°C for
5 min. PCR products were separated with 1.5% agarose gel and detected using Syngene
GeneGenius (Syngene) and ImageJ software. The ratio of methylation level of
NOTCH2NLC to that of unmethylation level was used to represent the
relative methylation level.
promoter region of expanded GGC repeats in the 5′ UTR of NOTCH2NLC gene.
RelaxGene Blood DNA System (Tiangen, DP349) and TIANamp Genomic DNA Kit (Tiangen, DP304)
were used to extract genomic DNA from blood and skeletal muscle samples, respectively. DNA
was converted using the DNA Bisulfite Conversion Kit (Tiangen, DP205). MSP was performed
using the methylation-specific PCR Kit (Tiangen, Em101) with the following primers:
methylation–specific-F: 5′-GAGGATCGTTTTTTTTTGTAAGTTTACGATTTC-3′; methylation-specific-R:
5′-AATCTACTACGAATCACTAACCCCG-3′; unmethylation-specific-F:
5′-GGATGAGGATTGTTTTTTTTTGTAAGTTTATGATTTT-3′; unmethylation-specific-R:
5′-CAAAAAAATCTACTACAAATCACTAACCCCA-3′. PCR conditions were as follows: 95°C for 5 min,
followed by 35 cycles of 94°C for 20 s, 60°C for 30 s and 72°C for 20 s, and then 72°C for
5 min. PCR products were separated with 1.5% agarose gel and detected using Syngene
GeneGenius (Syngene) and ImageJ software. The ratio of methylation level of
NOTCH2NLC to that of unmethylation level was used to represent the
relative methylation level.
3
Protein Analysis of CAFs and Apoptosis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular proteins were prepared from cell lysates with lysis buffer. As for CAFs related proteins detection, cells were treated with TPL at the concentration of 12.5 nM or 25 nM for 48 h before protein extraction. As for apoptosis-related proteins detection, cells were treated with SN38 (1 μM), TPL (12.5 nM) or SN38 (1 μM) plus TPL (12.5 nM) for 24 h with before protein extraction. Co-cultured of GC cells and CAFs were conducted as described above. Then the cells were treated with SN38 (1 μM), TPL (12.5 nM) or SN38 (1 μM) plus TPL (12.5 nM) for another 24 h. After the protein concentration of each sample was adjusted, SDS–polyacrylamide gel electrophoresis was performed to separate proteins. Subsequently, the protein bands were transferred to a polyvinylidene fluoride (PVDF) membrane. The specific primary antibodies were used as follows: FAP (Abcam, ab207178, 1:1000), α-SMA (Sigma, A2547, 1:1000), PARP (Proteintech, 66,520, 1:5000), Caspase 3 (Proteintech, 19,677, 1:1000), Bax (Proteintech, 60,267, 1:5000), Cyclin B1 (CST, #4318, 1:1000), Cyclin D1 (CST, #2978, 1:1000), Phospho-NF-κB p65 (Ser536) (CST, #3033, 1:1000), NF-κB p65 (CST, #8242, 1:1000), GAPDH (CST, #97,166, 1:1000). The level of target proteins was detected using the Syngene GeneGenius gel imaging system (Syngene, Cambridge, UK).
4
G. vaginalis 16S rRNA gene detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 16S rRNA gene specific to G. vaginalis was amplified using primers: forward: 5′-TTCGATTCTGGCTCAGG and reverse: 5′-CCATCCC AAAAGGGTTAGGC. The primers were synthesized based on their published sequences described by Pleckaityte et al. [15 (link)]. The PCR was performed in a 50 μL final volume and comprised 0.2 μM of each primer, 30 ng of genomic DNA, and 1.5 U of High-Fidelity PCR enzyme mix (ThermoFisher Scientific, Massachusetts, United States). The reaction mixture was subjected to 28 cycles of denaturation at 94°C for 30 seconds, primer annealing at 52°C for 45 seconds, and extension at 72°C for 1 minute 25 seconds. PCR conditions were as per Pleckaityte et al. [15 (link)]. All PCR reactions were performed using a T100 thermocycler (BioRad, California, United States). The PCR products were separated on a 1% agarose gel and viewed under a UV transilluminator (Gene Genius, SYNGENE).
5
Methanol Fixation and Methylene Blue Staining
6
Cardiac Protein Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole cell extracts from cardiac tissue or cultured myocytes were prepared by using cell lysis buffer system (Santa Cruz). Nuclear extraction reagents (Pierce) and cytoplasmic extraction reagents (Pierce) were used to extract nuclear proteins and cytoplasmic proteins respectively according to the protocol provided by the manufacturer. Concentrations of protein samples were determined by BCA protein assay kit (Pierce). 20 μg of protein samples were loaded and then separated by SDS-PAGE. The protein samples were transferred electrically to PVDF or NC membranes which were then incubated with primary antibodies against p38 MAPK (Cell Signaling Tech, 1: 1,000), phospho-p38 MAPK (p-p38 MAPK, Cell Signaling Tech, 1: 1,000), JNK (Abcam, 1: 500), phospho-JNK (p-JNK, Abcam, 1: 500), ERK1/2 (Cell Signaling Tech, 1: 1,000), phospho-ERK1/2 (p-ERK1/2, Cell Signaling Tech, 1: 1,000), Nrf2 (Invitrogen, 1: 500), HO1 (Santa Cruz, 1: 1,000), Prx1 (Santa Cruz, 1: 1,000), GAPDH (Santa Cruz, 1: 2,000) and Lamin A (Santa Cruz, 1: 1,000) at 4°C for 10 hours. After washing with TBST, membranes were incubated with horseradish peroxidase conjugated secondary antibodies (1: 5,000) at room temperature for one hour. ECL kit (Pierce) was used to incubate the membranes which were then exposed with Gene Genius (Syngene); then the intensities of the immunoblots were analyzed by software ImageJ.
7
Topoisomerase II Alpha Inhibition Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
This topo IIα assay, along with additional assays described in Section 2.2 , were performed in collaboration with Inspiralis (Norwich, UK). One U of topo II was incubated with 200 ng kDNA in a 30 μL reaction at 37 °C for 30 min under the following conditions: 50 mM Tris HCl (pH 7.5), 125 mM NaCl, 10 mM MgCl2, 5 mM DTT, 0.5 mM EDTA, 0.1 mg/mL bovine serum albumin (BSA), and 1 mM ATP. The reaction was then stopped by the addition of 30 μL chloroform/isoamyl alcohol (26:1) and 30 μL Stop Dye (40% sucrose (w/v), 100 mM Tris. HCl (pH 7.5), 10 mM EDTA, 0.5 μg/mL bromophenol blue) before being loaded on a 1% TAE gel run at 85 V for 90 min.
Bands were visualized via ethidium bromide staining for 15 min and destained for 10 min. Gels were scanned using documentation equipment (GeneGenius, Syngene, Cambridge, UK), and inhibition levels were calculated from the band data obtained with the gel scanning software (GeneTools, Syngene, Cambridge, UK). Assays were performed for active compound2 at concentrations of 12.5, 50, 100, and 200 μM and for etoposide standard at concentrations of 3.9, 31.5, 125, and 500 μM.
Bands were visualized via ethidium bromide staining for 15 min and destained for 10 min. Gels were scanned using documentation equipment (GeneGenius, Syngene, Cambridge, UK), and inhibition levels were calculated from the band data obtained with the gel scanning software (GeneTools, Syngene, Cambridge, UK). Assays were performed for active compound
8
Methylation Analysis of CRBN Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic DNA was extracted from the cultured cells and subjected to MS-PCR analysis as described [36 (link)]. Briefly, U266 and MM1.R cells were treated with DMSO control, 8 μM LG100754, 4 μM Bexarotere, 4 μM AGN194204, or 4μM LG101506 for 48 h. The cells were then harvested, and the DNA was isolated using a tissue/cell genomic DNA isolation kit with the Wizard DNA clean-up kit (Promega, Fitchburg, WI, USA). The DNA was then treated with bisulfite according to the manufacturer’s instructions (EZ DNA Methylation Kit, Zymo Research, Irvine, CA, USA), and amplified by PCR with two pairs of specific primers that recognize the methylated (M) and the unmethylated (U) CpG sites in the CRBN promoter. The primers were designed using the MethPrimer program (http://www.urogene.org/methprimer/ accessed on 23 June 2023). The primer pair for the methylated form (129 bp) was as follows: forward: GAATAAAGTGAGGGTTTTGTAGC; reverse: ACCTAAAAATAATAACCTAAACGAA. The primer pair for the unmethylated form (131 bp) was the following: forward: TGGAATAAAGTGAGGGTTTTGTAGT; reverse: ACCTAAAAATAATAACCTAAACAAA. The PCR amplification conditions were 95 °C for 5 min; 40 cycles at 95 °C for 45 s, 60 °C for 45 s, 72 °C for 45 s, and, finally, 10 min at 72 °C. The PCR products were visualized in Gene Genius (Syngene, Cambridge, UK) by ethidium bromide staining in 2% agarose gels.
9
Protein Extraction and Western Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cultured BMECs were subjected to the Cell Lysis Buffer System (Santa Cruz, USA) supplemented with phenylmethylsulfonyl fluoride (PMSF, Santa Cruz, USA). A Cytoplasmic Extraction Kit (Beyotime, China) was used to extract the protein according to the manufacturer’s instructions. A BCA kit (Pierce, USA) was used to determine the protein concentrations of the samples, which were then subjected to the vertical SDS-PAGE. The separated proteins were then electronically transferred to PVDF membranes. Primary antibodies against Bax (Abcam, USA), Bcl-2 (Abcam, USA), activated caspase3 (Abcam, USA), p38 (Abcam, USA), phosphorylated p38 (p-p38, Abcam, USA), JNK (Abcam, USA), phosphorylated JNK (p-JNK, Abcam, USA), ERK1/2 (Abcam, USA), phosphorylated ERK1/2 (p-ERK1/2, Abcam, USA), and GAPDH (Abcam, USA) were used to incubate the membranes at 4°C for 8 h. The membranes were washed with TBST and then incubated with HRP-conjugated secondary antibodies. The membranes were developed by using an ECL kit (Pierce, USA). The densities of the immunoblots were determined and analyzed by Gene Genius (Syngene, England) and Image J (VER1.28, NIH, USA). Six independent experiments were carried out for immunoblots density quantification.
10
Western Blot Analysis of Notch Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A cell lysis buffer system (Santa Cruz) was used to prepare the whole-cell extracts on dry ice. The Nuclear Extraction Reagents (Pierce) and Total Protein Extraction kit (Beyotime) were used according to the protocol provided by the manufacturers. The protein concentrations were detected with a BCA protein assay kit (Pierce). Vertical SDS-PAGE was used to separate the protein samples, which were then transferred to the PVDF membranes. After blocking with 10% defatted milk, primary antibodies against Delta-like 1 (DLL1, Sigma-Aldrich, 1: 2000), DLL3 (Sigma-Aldrich, 1: 2000), DLL4 (Sigma-Aldrich, 1: 2000), Jagged1 (Abcam, 1: 2500), Jagged2 (Abcam, 1: 2500), NICD (Cell Signaling Tech, 1: 4000), PI3K (Cell Signaling Tech, 1: 2000), Akt (Cell Signaling Tech, 1: 2000), phosphorylated Akt (p-Akt, Cell Signaling Tech, 1: 2000), Bcl2 (Abcam, 1: 2500), active caspase3 (Abcam, 1: 2000), GAPDH (Abcam, 1: 2000), and Histone H3 (Abcam, 1: 2000) were incubated at 4°C for 8 h. Then, the secondary antibodies were used to incubate the membranes at room temperature for 1 h. An ECL kit (Pierce) was used to develop the membranes, which were then exposed with Gene Genius (Syngene). Image J software was used to analyze the densities of the blots.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!