Primescript rt reagent kit

100 mg of subcutaneous xenograft tissues from each of the Apatinib group and the control group was used for this investigation. The total RNA was extracted using RNA extraction reagent Trizol (Life Technologies, Grand Island, NY, USA) following the manufacturer's instructions. Reverse transcription was performed with PrimeScript RT Reagent Kit (Vazyme, Thermo Fisher, NY, USA). qRT-PCR was carried out with the SYBR® Green PCR Master Mix (Life Technologies, Grand Island, NY, USA) in conformity with the manufacturer's instructions. The sequences for sense (S) and antisense (A) primers are shown in Table 1.

The salt-tolerant glutaminase gene sequence from M. luteus K-3 in the NCBI database (Accession number: DQ019448.1) was designed and synthesized according to the preference of B. subtilis (the codon optimization result is shown in Figure S1 in the Supplementary Materials) by Sangon Biotech., Ltd. (Shanghai, China). PCR reagents, T4 DNA ligase, and restriction enzymes were purchased from TaKaRa (Dalian, China), and RNAiso Plus, the PrimeScript RT Reagent Kit and ChamQ^TMSYBR^®qPCR Master Mix were purchased from Vazyme (Nanjing, China). Mini Plasmid Rapid Isolation and Mini DNA Rapid Purification Kits were purchased from Sangon Biotech (Shanghai, China). Experiments were performed in accordance with the manufacturer’s instructions.

In vitro, BV2 cells and primary microglia seeded in 12-well plates were treated with EF for 2 h, prior to LPS-stimulation for another 3 h. In vivo, the mice subjected to tMCAO surgery were euthanized 3 days later with pentobarbital sodium (45 mg/kg i.p.) and put to death via cardiac perfusion with 1×PBS, then the tissues from ischemic-penumbra (right hemispheres) were extracted via 2% 2,3,5-triphenyltetrazolium chloride (TTC, Sigma-Aldrich) staining. Total RNA was isolated by using TRIzol reagent (Invitrogen) and reverse-transcribed into cDNA with PrimeScript RT Reagent Kit (Vazyme, Nanjing, China) according to the protocols. Preparing a 10ul reaction mixture before real-time PCR was performed using a LightCycle^® 96 Instrument Software system with SYBR Green Kit (Applied Biosystems). Primer sequences used were listed in Supplementary Table S1.

The ginger samples were ground into powder using liquid nitrogen, and the total RNA was extracted using a Plant RNA Extraction Kit (Vazyme, Nanjing, China) according to the manufacturer’s instruction. Then, the qualified RNA was used for cDNA synthesis using the Vazyme PrimeScript RT reagent kit (Vazyme, Nanjing, China). RT-qPCR was conducted on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, United States). Each reaction contained 5 μl of 2× Maxima SYBR Green qPCR Master Mix (Vazyme, Nanjing, China), 2.5 μl of diluted cDNA (400 ng) template, and 10 μM of gene-specific primers; then, nuclease free water was added to 20 μl. The average threshold cycle was obtained to evaluate the relative expression levels using the 2^–ΔΔCt method. The primer sequences of the MYB genes were adopted from Li et al. (2020) (link), and other genes’ primer sequences were designed by Primer Premier 5.0 (PREMIER Biosoft International, Palo Alto, CA, United States). The primers sequences used in this study are listed in Supplementary Table 1. Three biological and technical replicates were used for each sample along with a template-free control to check for any contamination.

Total RNA from cells and patients was isolated using TRIzol (Invitrogen, USA). RNA concentrations were measured using a NanoDrop 2000 (Thermo Fisher Scientific). The RNA (1 µg) was reverse-transcribed using PrimeScript RT reagent Kit (Vazyme, China). qRT−PCR was performed using SYBR Green master mix (Vazyme, China). The primer sequences were as follows: PFDN2-fw: 5′-ATGAGCACAGCCTAGTGATCG-3′; PFDN2-rev: 5′-ACTCCTCCAACCATGCGGTA-3′.

The total RNA was isolated from cells or tissues by TRIzol (15,596,018, Thermo, Waltham, MA, USA). The quantity and quality of RNA were determined spectrophotometrically and subsequently reversed transcription into cDNA following the PrimeScript™ RT reagent kit (R232-01, Vazyme, Nanjing, China). The expression of AL162457.2 was determined by SYBR Green Master Mix (Q111-02, Vazyme, Nanjing, China). qRT-PCR was then conducted on the LightCycler 480 Real-Time PCR System (Roche Diagnostics, Basel, Switzerland), with GAPDH serving as the internal control for AL162457.2. To calculate the level of AL162457.2, the 2^−∆∆CT method was used. All primers used for qRT-qPCR were produced by Tsingke Biotech (Tsingke, Beijing, China), and the following is a list of primer sequences: AL162457.2 (Forward): TACAAATCAGGAGGAAAA; AL162457.2 (Reverse): AGTGGAGAGATGAGGGTG. GAPDH (Forward): GGCCTCCAAGGAGTAAGACC; GAPDH (Reverse): AGGGGAGATTCAGTGTGGTG.