Morpholino antisense oligonucleotide

Antisense morpholino oligonucleotides (MO) were purchased from Gene Tools and micro-injected into one or two-cell stage embryos. A splice modifying MO was used, targeting the boundary of exon 2 and intron 2–3 of the zebrafish tfam gene (Ensemble: ENSDART00000092009, tfam splice-MO: 5′-CGGCAGATGGAAATTTACCAGGATT-3 ′). For controlling the effect of the MO injection, an equal concentration of a standard control-morpholino (Ctrl-MO: 5′-CCTCTTACCTCAGTTACAATTTATA-3′) was used in separate embryos of the same batch during each experiment. All MOs were dissolved in 1× Danieau buffer (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO₄, 0.6 mM Ca(NO₃)₂, and 5.0 mM HEPES pH 7.6) and 0.5% rhodamine dextran (Thermo Fisher) was added to the MO solution upon injection. At 1 hpf, 1 nl was injected into each embryo using microinjection (Bill et al., 2009 (link)). The next day, distribution of the rhodamine dextran dye was checked using fluorescence stereomicroscopy to verify proper injections. Only those embryos in which the rhodamine dextran dye was visible were used for follow-up investigations.

Antisense morpholino oligonucleotides (MO; Gene Tools, USA) were suspended in water as 1 mM stock solution and diluted with 0.2 M KCl to the appropriate concentration prior to use. Phenol Red (Sigma, USA) was added as an indicator at a final concentration of 0.05%. A microinjector (Eppendorf Femtojet; Eppendorf, Germany) was used to inject 4 nl of MO solution into the yolk of fertilized eggs at the 1 to 2 cell stage. The injected embryos were incubated at 24°C, and morpholino‐injected specimens were phenotyped at the late embryonic stage. Embryos at 2 to 3 days post‐fertilization were categorized based on morphology. All morpholino‐injected specimens were observed under a stereomicroscope (SZX16 and SZ16; Olympus, Japan). To minimize the risk of misinterpreting off‐target effects as being due to MO‐induced knockdown of szl, we compared the morphant phenotypes to those of previously reported ogon/sizzled and other DV patterning–related gene mutant zebrafish (Hammerschimidt et al., 1996; Kishimoto, Lee, Zon, Hammerschmidt, & Schulte‐Merker, 1997; Muraoka et al., 2006; van Eeden et al., 1996; Yabe et al., 2003). To avoid possible bias from different handling times, the order of MO injections was varied.

To target the start codon of the tamalin, Arf6a, and Arf6b mRNA, we purchased antisense morpholino oligonucleotides (MO) from Gene tools. The MOs were injected into fertilized embryos at the one-cell stage, after being dissolved in nuclease-free water with 1% phenol red. We used the following MOs: Tamalin ATG MO: 5′-TCCGCGTGTCACTCAGTTAGACAGA-3′ and Arf6 ATG MO: 5′-GATCTTGGAAAGCATCTTCCCCATG-3′ [41 (link)]. To confirm MO specificity, we produced hsp70:arf6a-mcherry:pA and hsp70:arf6b-mcherry:pA constructs. The ORF of Arf6a and Arf6b with attB1 and attB2 site containing primers were amplified, and the product was cloned into a middle entry vector by a gateway system (Invitrogen). The 5′ entry clone has a heat shock promoter, the middle entry clone has Arf6a, and Arf6b ORF and 3′ entry clone has the mCherry-polyA gene. We used LR clonase II (Invitrogen) for the LR reactions. The primers were designed using the following sequences:
Arf6a attB1 forward: GGGGACAAGTTTGTACAAAAAAGCAGGCTGATTTATGCCCAGCCAACACCATG; Arf6a attB2 reverse: GGGGACCACTTTGTACAAGAAAGCTGGGTAGGATTTGTAGTTGGACGTGAGCC; Arf6b attB1 forward: GGGGACAAGTTTGTACAAAAAAGCAGGCTCATTTATGAACAGTTTACAAGATG; and Arf6b attB2 reverse: GGGGACCACTTTGTACAAGAAAGCTGGGTAAGACTTGTAGTTAGATGTTAAC.

Antisense morpholino oligonucleotides (MO) against syn4: TGAGGTAAACTTTCAACAT CTTCTC were purchased from Gene Tools (Philomath, OR, USA) and used as previously described17 (link). The mRNAs and MO were injected into the yolk and the plasmid was injected into the cell at the one cell stage. Unless stated otherwise, a volume of 1 nl was injected into embryos with the concentration of 6 ng/nl of MO, 100–150 ng/ul of mRNA and 100–200 ng/ul of plasmid.