3 3 dithiodipropionic acid

Manufactured by Merck Group

Sourced in United States

3,3'-dithiodipropionic acid is a chemical compound used in various laboratory applications. It serves as a precursor for the synthesis of other chemical compounds and is utilized in research and development activities.

Automatically generated - may contain errors

Lab products found in correlation

11 protocols using 3 3 dithiodipropionic acid

Heavy Metal Removal Sponge Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Absorbable gelatin sponges (60 mm × 20 mm × 5 mm) were purchased from Nanchang Xiangentang medical equipment Co. Ltd. (Xixiang, China). N-hydroxysuccinimide (NHS), branched polyethylenimine (PEI) with a molecular weight of 800 Da, 3,3′-dithiodipropionic acid, ethanol, dimethylformamide and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Stock aqueous solutions of lead and cadmium (1 mg mL⁻¹) were purchased from the National Institute of Metrology of China and then dissolved with ultrapure water.

Li B., Zhou F., Huang K., Wang Y., Mei S., Zhou Y, & Jing T. (2016). Highly efficient removal of lead and cadmium during wastewater irrigation using a polyethylenimine-grafted gelatin sponge. Scientific Reports, 6, 33573.

+ Open protocol

+ Expand

Dendrimer-based Chemotherapeutic Delivery

Check if the same lab product or an alternative is used in the 5 most similar protocols

G4 PAMAM dendrimer (10 wt% solution in methanol), glucose, camptothecin, 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC), 3,3'-dithiodipropionic acid, and 4-dimethylaminopyridine (DMAP) were purchased from Sigma-Aldrich Co., LLC (St. Louis, MO). glucose–PEG–NHS and mPEG–NHS were obtained from Jiankai Technology Company (Beijing, China). The fluorescent probes Basic Orange 14, Cy7-NHS, and MitoTracker Red were all obtained from FanBo Biochemical Corporation (Beijing, China). Dulbecco’s modified Eagle’s medium (DMEM), 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide (MTT), and fetal bovine serum (FBS) were purchased from Gibco Life Technology Company (Grand Island, NY). HepG2 and L02 cells were gifts from Dr. Dengke Li of the School of Life Science of Beijing University of Chinese Medicine. Male Kunming mice and Sprague–Dawley rats were obtained from Sibeifu Laboratory Animal Technology Company (Beijing, China).

Ma P., Sun Y., Chen J., Li H., Zhu H., Gao X., Bi X, & Zhang Y. (2017). Enhanced anti-hepatocarcinoma efficacy by GLUT1 targeting and cellular microenvironment-responsive PAMAM–camptothecin conjugate. Drug Delivery, 25(1), 153-165.

+ Open protocol

+ Expand

Biotin-TEG Modified AFM1 Aptamer Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

An AFM1 binding ssDNA aptamer ‘AFAS3’ (Malhotra et al. 2014 (link)) was extended by incorporating tetraethyleneglycol (TEG) and biotin at 3′-end of aptamer. The sequence of aptamer used was ⁵′ATCCGTCACACCTGCTCTGACGCTGGGGTCGACCCGGAGAAATGCATTCCCCTGTGGTGTTGGCTCCCGTAT-TEG-Biotin³′. The secondary structure of AFM-binding aptamer was predicted by Mfold programme (Fig. 2). HPLC purified aptamer was procured from Avantor Performance Materials India Ltd., Gurgaon, India. 3,3′-dithiodipropionic acid, and N-(3-dimethylaminopropyl)-N-ethylcarbodiimide (EDC) were from Sigma-Aldrich, USA. The N-hydroxysuccinimide (NHS) and streptavidin were purchased from Fluka, USA. Aflatoxins were procured from HiMedia Bioscience, India. Pure water having resistivity of 18.2 MΩ was used for electrode washing and sample preparation. All other chemicals used were of analytical grade.Fig. 2

Secondary structure of the 3′ Biotin-tetraethylene glycol (TEG) modified aflatoxin M1 binding aptamer ‘AFAS3’

Pandey A.K., Rajput Y.S., Sharma R, & Singh D. (2017). Immobilized aptamer on gold electrode senses trace amount of aflatoxin M1. Applied Nanoscience, 7(8), 893-903.

+ Open protocol

+ Expand

Sugar Beet Leaves Phytochemical Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

The SBLs were of a sugar beet plant (Beta Vulgaris L., var. SMART DJERBA-KWS) aged 10 months (March–January 2021), cultivated at a local farm in Padova, Italy. The area and weight of the SBLs were about 20–30 cm² and 2–3.5 g, respectively. They were transported to the laboratory in thermal boxes.
All the chemicals and solvents used in this work were of analytical grade. Sodium hydroxide, citric acid, sodium citrate tribasic dehydrate, sulfuric acid, hydrochloric acid, EtOH, MeOH, polyvinylpolypyrrolidone, triton X-100, 3,3′-dithiodipropionic acid, barium hydroxide, sodium acetate, potassium carbonate, sodium methoxide, acetonitrile, sodium carbonate, Folin–Ciocalteu reagent, gallic acid, Trolox, iron(III) chloride, 2,4,6-Tri(2-pyridyl)-s-triazine (TPTZ), and 2,2-diphenyil-1- picrylhydrazyl (DPPH) were bought from Sigma (St. Louis, MO, USA). AccQTag Ultra Derivatization Kit, and 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate (AQC) were purchased from Waters (Milford, CT, USA). The water utilized in all the analyzes was deionized and distilled.

Ebrahimi P., Mihaylova D., Marangon C.M., Grigoletto L, & Lante A. (2022). Impact of Sample Pretreatment and Extraction Methods on the Bioactive Compounds of Sugar Beet (Beta vulgaris L.) Leaves. Molecules, 27(22), 8110.

+ Open protocol

+ Expand

Functionalized Lipid Bilayer Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

3-Mercaptopropyltrimethoxysilane (MPTES, 95%) was purchased from
ABCR GmbH (Karlsruhe, Germany). Gold granules (99.99%) for evaporation
were obtained from Mateck GmbH (Juelich, Germany). Bio-beads (20–50
mesh) were purchased from Bio-Rad Laboratories GmbH (Vienna, Austria).
1,2-Diphytanoyl-sn-glycero-3-phosphocholine (DiPhyPC,
>99%) was provided by Avanti Polar Lipids (Alabaster, Alabama,
USA). Dithiobis (nitriloacetic acid butylamidyl propionate) (DTNTA,
≥95.0%) was obtained from Dojindo Laboratories (Kumamoto,
Japan). Hydroxylamine hydrochloride (NH₂OH.HCl, 99%),
gold(III) chloride hydrate (HAuCl₄.xH₂O, 99.999%),
dimethyl sulfoxide (DMSO, puriss., dried over molecular sieve),
3,3’-dithiodipropionic acid (DTP, 99%),
dodecyl-β-D-maltoside (DDM, ≥98%), nickel(II) chloride
(NiCl₂, 98%), D-(+)-glucose
(C₆H₁₂O₆, ≥99.5%), glucose
oxidase (GOX) and catalase, as well as ubiquinone-10 (Q-10,
2,3-dimethoxy-5-methyl-6-all-trans-decaprenyl-1,4-benzoquinone)
were purchased from Sigma-Aldrich (Steinheim, Germany). All chemicals were used
as purchased.

Geiss A.F., Khandelwal R., Baurecht D., Bliem C., Reiner-Rozman C., Boersch M., Ullmann G.M., Loew L.M, & Naumann R.L. (2017). pH and Potential Transients of the bc1 Complex Co-reconstituted in Proteo-Lipobeads with the Reaction Center from Rb. sphaeroides. The journal of physical chemistry. B, 121(1), 143-152.

+ Open protocol

+ Expand

Synthesis of PEG-Functionalized Magnetic Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following reagents were manufactured by Sigma Aldrich, USA: Iron(III) acetylacetonate (≥97.0%), Triethylene glycol (TEG) (99%), Sodium nitrite (NaNO₂) (≥97.0%), Sodium hydrocarbonate (NaHCO₃) (≥99.7%), Sulfuric acid (H₂SO₄) (95–98%), Phosphate-buffered saline (PBS), Dopamine hydrochloride (MQ 200), 3,3′-dithiodipropionic acid NHS ester (NHS-DTDP), N-Hydroxysuccinimide (NHS) (≥ 97.0%), Polyethylene glycol-acetic acid 2-aminoethyl ester, M = 3500 g/mol (NH₂-PEG-COOH), α,ω -bis{2-[(3-carboxy-1-hydroxypropyl)amino]ethyl}Polyethylene glycol, M = 3000 g/mol (PEG-COOH), N,N-Dimethylformamide (DMF) (≥99.8%), 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (≥97.0%), N,N-Diisopropylethylamine (DIPEA) (≥99%), Dithiothreitol (DTT) (≥95%), 3,3′-dithiodipropionic acid (DTDP) (≥99%), Dimethyl sulfoxide (DMSO) (≥99%), and Epon resin. 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTS) was manufactured by Promega, USA. Paraformaldehyde OH(CH₂O)nH (n = 8–100) was manufactured by Biovitrum, Russia. Cy5 NHS-ether and Cy3 amine dyes were manufactured by Lumiprobe, Russia. Ethanol (95%) was manufactured by Komponent-reactive, Russia. Deionized water was obtained in the Laboratory of Biomedical nanomaterials, NUST MISIS, Russia.

Nizamov T.R., Iliasov A.R., Vodopyanov S.S., Kozhina I.V., Bordyuzhin I.G., Zhukov D.G., Ivanova A.V., Permyakova E.S., Mogilnikov P.S., Vishnevskiy D.A., Shchetinin I.V., Abakumov M.A, & Savchenko A.G. (2022). Study of Cytotoxicity and Internalization of Redox-Responsive Iron Oxide Nanoparticles on PC-3 and 4T1 Cancer Cell Lines. Pharmaceutics, 15(1), 127.

+ Open protocol

+ Expand

Biodegradable Doxorubicin Nanocarriers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Methyl ether poly(ethylene glycol) (mPEG, M n = 5000, M w /M n < 1.3), acryloyl chloride (AC, 98 %), triethylamine (TEA, > 99 %), 1,4-butylenediacrylate (BD, > 99 %), 3-amino-1-propanol (AP, > 99 %), 3,3'-dithiodipropionic acid (DTDP, > 99 %), acetyl chloride (> 98 %), N,N'-dicyclohexylcarbodiimide (DCC, > 99 %), 4-(dimethyl amino) pyridine (DMAP, > 99 %), glutathione (GSH, > 98 %) were purchased from Sigma-Aldrich (St Louis, MO, USA). Doxorubicin hydrochloride (DOX-HCl) was purchased from Wuhan Yuan Cheng Gong Chuang Co. (Wuhan, China). Dichloromethane (DCM, ≥99.8 %), dimethyl formamide (DMF, ≥99.8 %), chloroform (>99 %), dimethyl sulfoxide (DMSO, ≥99.9 %) and all other chemical reagents were used as received. Phosphate-buffered saline (PBS) buffers, fetal bovine serum (FBS), methylthiazoltetrazolium (MTT), Dulbecco's Modified Eagle's medium (DMEM), trypsin, penicillin and streptomycin and other biological materials were purchased from purchased from Lonza (Walkersville, MD). Lewis lung carcinoma (3LL) cell line was obtained from the American Type Culture Collection (ATCC) and cultured under the recommended conditions according to the supplier. All other biological reagents were used as received.

Zhang S., Zhu P., He J., Dong S., Li P., Zhang C.Y, & Ma T. (2020). TME-Responsive Polyprodrug Micelles for Multistage Delivery of Doxorubicin with Improved Cancer Therapeutic Efficacy in Rodents. Advanced healthcare materials, 9(18).

+ Open protocol

+ Expand

Disulfide Compounds Characterization Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

(±) α-Lipoic acid, 3,3′-dithiodipropionic acid (DTDPA), bis-(2-hydroxyethyl) disulfide (2-OH-SS), L-glutathione disulfide (GSSG), cystamine dihydrochloride, trans-4,5-dihydroxy-1,2-dithiane (4,5-(OH)₂-dithiane), 5,5′-dithiobis-(2-nitrobenzoic acid) (DTNB), α-lactalbumin and recombinant human insulin (from Saccharomyces cerevisiae) were obtained from Sigma-Aldrich (Castle Hill, NSW, Australia). Fmoc-Met, Fmoc-MetSO, and the disulfides (N-Ac-Cys-OH)₂, (H-Cys-Gly-OH)₂, (H-Gly-Cys-OH)₂, (Boc-Cys)₂ were from Bachem (Bubendorf, Switzerland). (±) α-Lipoamide was obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). di-N-acetyl-glutathione disulfide [(N-Ac)₂-GSSG] was from Auspep (Tullamarine, Vic, Australia). 4-Methyl-1,2-dithiolane-4-carboxamide (4-Me-dithiolane-CONH₂) was from Ambinter (GreenPharma, Orleans, France). Samples were prepared in 0.1 M phosphate buffers (pH 7.4) using Nanopure water (four-stage Milli-Q system; Millipore, NorthRyde, Australia). Buffers were treated with washed Chelex resin (Bio-Rad, Gladesville, NSW, Australia) to remove contaminating transition metal ions.

Karimi M., Ignasiak M.T., Chan B., Croft A.K., Radom L., Schiesser C.H., Pattison D.I, & Davies M.J. (2016). Reactivity of disulfide bonds is markedly affected by structure and environment: implications for protein modification and stability. Scientific Reports, 6, 38572.

+ Open protocol

+ Expand

Camptothecin-Polymer Bioconjugate Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

4-dimethylaminopyridine (DMAP), N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC), copper(II) sulfate (CuSO₄), (+)-sodium L-ascorbate, magnesium sulfate MgSO₄, dichloromethane (DCM), tetrahydrofuran (THF), deuterated solvents, and other solvents were purchased from Acros (Morris Plains, NJ). (S)-(+)-Camptothecin (95%) (CPT), 3,3′-dithiodipropionic acid (DDPA), dithiothreitol (DTT), copper bromide (CuBr), 2,2’-bipyridine, 4-dimethylaminopyridine (DMAP), O-(2-Azidoethyl)nonadecaethylene glycol, N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC), and silica gel 60 (40–63 μm, 230–400 mesh) were purchased from Sigma-Aldrich (St. Louis, MO). SnakeSkin dialysis tubing, MWCO 3500 and 7000 Da, was obtained from Thermo Fisher Scientific (Pittsburg, PA). Azido-3,6,9,12,15-pentaoxaoctadecan-18-oic acid (APO) was purchased from Biomatrik (Jiaxing, Zhejiang, China). PEAMO (Mn = 6468 g mol⁻¹) and methoxypoly(ethylene glycol) azide (750 g mol⁻¹) (mPEG750-azide ) synthesized by us [22 ] were used.

Allen J., Wang J., Zolotarskaya O.Y., Sule A., Mohammad S., Arslan S., Wynne K., Yang H, & Valerie K. (2020). PEAMOtecan, a novel chronotherapeutic polymeric drug for brain cancer. Journal of controlled release : official journal of the Controlled Release Society, 321, 36-48.

+ Open protocol

+ Expand

Amine-Functionalized Carbon Nanoparticles for Doxorubicin Delivery

Check if the same lab product or an alternative is used in the 5 most similar protocols

Amine-functionalized CNPs were synthesized by the pyrolysis of L-glutamic acid (the detailed procedure is described in our previous report [25 (link)]). 3,3′-Dithiodipropionic acid (SS-COOH, 99%), polyethylene glycol (PEG, MW = 3000 g/mol), 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC, >97%), 4-dimethylaminopyridine (DMAP, >98%), N-hydroxysuccinimide (NHS, 98%), and doxorubicin hydrochloride (DOX, -NH₃⁺Cl⁻ salt form, >98%) were obtained from Aldrich (St. Louis, MO, USA), and βCD (>98%) obtained from TCI (Tokyo, Japan) were purchased and used as received. HER was purchased from Roche (Basel, Switzerland), and Roswell Park Memorial Institute (RPMI) 1640 media, Dulbecco’s phosphate-buffered saline, trypsin-EDTA, and penicillin-streptomycin were purchased from Thermo Fisher Scientific (Waltham, MA, USA). Fetal bovine serum (FBS), CCK-8 reagent (product # CK04-13), and lysosomal staining reagent (product # ab176829) were purchased from GIBCO BRL (Grand Island, NY, USA), Dojindo (Kumamoto, Japan), and Abcam (Cambridge, MA, USA), respectively.

Ko N.R., Van S.Y., Hong S.H., Kim S.Y., Kim M., Lee J.S., Lee S.J., Lee Y.K., Kwon I.K, & Oh S.J. (2020). Dual pH- and GSH-Responsive Degradable PEGylated Graphene Quantum Dot-Based Nanoparticles for Enhanced HER2-Positive Breast Cancer Therapy. Nanomaterials, 10(1), 91.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!