The largest database of trusted experimental protocols

Rnai mate

Manufactured by GenePharma
Sourced in China

RNAi-Mate is a laboratory equipment designed for RNA interference (RNAi) experiments. It facilitates the introduction of small interfering RNA (siRNA) or short hairpin RNA (shRNA) into cells to induce gene silencing. The core function of RNAi-Mate is to enable efficient delivery of these RNA molecules into the target cells, allowing researchers to study gene function and expression.

Automatically generated - may contain errors

32 protocols using rnai mate

1

Microglia TREM2 Silencing and OGDR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Normal culture medium was used, and cells were exposed to ambient air until transfection. The TREM2 siRNA mixtures (TREM2-siRNA1, 5′-GAGGGUGUCAUGUACUUAUTT-3′; TREM2-siRNA2,5′-CCUCUAGAUGACCAAGAUTT-3′;TREM2-siRNA3,5′-GGAAUCAAGAGACCUCCUUTT-3′) or control siRNA (5′-UUCUCCGAACGUGUCACGUTT-3′) was transfected into primary microglia cells for 36h using siRNA or RNAi-Mate (a mixture of control siRNA and RNAi-Mate, GenePharma, Shanghai, China) using the protocol provided by the manufacturer. Following transfection, the cells were exposed to OGDR as described above.
+ Open protocol
+ Expand
2

Silencing HOTAIR and MKL1 in HeLa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human cervical cancer cell line HeLa obtained from American Type Culture Collection were grown in DMEM (Hyclone, USA) at 37 °C with 5% CO2 in air containing 10% fetal bovine serum (FBS), 2 mM glutamine, 50 U/ml penicillin and 50 mg/ml streptomycin. For silencing the expression level of HOTAIR, 20 nM of siRNA targeted against HOTAIR (siHOTAIR-I or siHOTAIR-II) or a negative control siRNA (siNC) were transfected into HeLa cells using RNAi-mate (GenePharma, Shanghai, China). The RNA expression of HOTAIR was measured at 48 h after transfection by quantitative real-time PCR (qRT-PCR) as described below. The siRNA sequences were listed in Additional file 1: Table S1–1.
For MKL1 gene silencing, HeLa cells were transfected with 20 nM of siRNA targeted against MKL1 (siMKL1-I, siMKL1-II or siMKL1-III) and a negative control siRNA (siNC). Transfection with 20 nM siMKL1 or siNC was performed using RNAi-mate (GenePharma, China). Cells were harvested at 48 h after transfection and MKL1 gene knockdown was assessed by Western blotting. All the siRNAs were purchased from GenePharma Co. Ltd. The siRNA sequences were listed in Additional file 1: Table S1–1.
+ Open protocol
+ Expand
3

MicroRNA-26a Regulation of MAPK6 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
For miR-26a overexpression, miR-26a agomir (GenePharma, China) was added to the complexes at final concentrations of 50 nM. For miR-26a knockdown, the miR-26a antagomir (GenePharma, China) was added to the complexes at final concentrations of 100 nM. Knockdown of MAPK6 expression was performed using MAPK6 siRNA-smart pool (DharmaconTM), with all negative siRNAs (GenePharma, China) as a control. Overexpression of MAPK6 was performed by inserting full-length rat MAPK6 cDNA into the pcDNA3.3 expression vector. Twelve hours after they were seeded into the 6-well plates, cells were transfected using either RNAi-MATE (GenePharma, China) or PolyJet™ DNA in vitro Transfection Reagent (SignaGen Laboratories, China) according to the manufacture’s protocol. Transfection medium was replaced by regular cell culture medium after 6 h of transfection.
+ Open protocol
+ Expand
4

Silencing RYR2 and RYR3 in Mast Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
MCs were plated at 1 × 106/ml and treated with 80 nM of RYR2- and RYR3-targeting siRNA or non-targeting siRNA with RNAi-Mate (at 1 μg/ml, GenePharma, Shanghai, China) for 48 h, and employed for downstream analyses. The siRNA sequences were as follows: RYR2 forward: 5’-GGCUCUAAUUAGAGGAAAUTT, RYR2 reverse: 5’-AUUUCCUCUAAUUAGAGCCTT, RYR3 forward: 5’-GCAGAUCAACAUGCUGCUUTT, and RYR3 reverse: 5’-AAGCAGCAUGUUGAUCUGCTT.
+ Open protocol
+ Expand
5

Cell Transfection and siRNA Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T or Vero cells were grown on plates to 70% to 80% confluence and then transfected with the indicated plasmids using StarFect high-efficiency transfection reagent (GeneStar, Beijing, China) in accordance with the manufacturer’s instructions. At the indicated posttransfection time points, cells were collected for use in further studies.
For siRNA knockdown, Vero cells were transfected with the indicated siRNA using RNAi-Mate (GenePharma, Shanghai, China) in accordance with the manufacturer’s instructions. All siRNA duplexes used in this study were designed and synthesized by GenePharma (Shanghai, Beijing). The sequences of the siRNAs used in this research are listed in Table 1. At 24 hpt, cells were retransfected with the corresponding siRNA, and at 48 hpt, cells were infected with rSG10 or rSG10-F23A at different MOIs.
+ Open protocol
+ Expand
6

NRF2 Knockdown in HUVECs

Check if the same lab product or an alternative is used in the 5 most similar protocols
HUVECs were seeded in a 12-well plate for overnight and then transfected negative control siRNA (siGFP, GCAGCACGACUUCUUCAAGUU) or siRNA targeting NRF2 (siNRF2, GGUUGAGACUACCAUGGUU) for 48 h using RNAi-Mate (#G04001, Gene Pharma, Shanghai) according to the manufacturer’s instruction. RNAi efficiency was detected with western blotting analysis.
+ Open protocol
+ Expand
7

Overexpression of Ku70 in SH-SY5Y Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
SH-SY5Y and HEK293T cells from the Shanghai Institutes for Biological Sciences were maintained in Dulbecco's modified Eagle's medium (DMEM, Gibco, Carlsbad, CA, USA) containing 10% fetal bovine serum (Gibco), 100 IU/ml penicillin, and 100 mg/ml streptomycin (Gibco). The cells were grown in a humidified incubator (37°C; 5% CO2), with medium renewal every 2 days. The cells within 10 passages were used for experiments.
The full-length human Ku70 cDNA was inserted into the lentiviral vector LV5 (GenePharma Co., Ltd., Shanghai, China) and confirmed by sequencing. Lentiviral constructs of the LV5 empty vector or LV5-Ku70 were cotransfected with viral packaging plasmids (pGag/pol, pRev, and pVSV-G) into HEK293T cells by RNAi-mate (GenePharma) based on manufacturers' instructions. The viral supernatant was collected 72 h following transfection, which was filtered through a 0.45 μm filter. Ku70-expressing lentivirus (Ku70+) or control lentivirus (LV5) was transfected into SH-SY5Y cells with 5 μg/ml Polybrene. The Ku70 expression was confirmed by RT-PCR and western blotting.
+ Open protocol
+ Expand
8

Modulating MET Expression in Prostate Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
PC cells (5 × 104 per well) were plated into the wells of six‐well plates and transfected with small‐interfering RNA (siRNA) sequences targeting MET (GenePharma; siMET 1: 5′‐GUGCCACU AACUACAUUUATT‐3′ and siMET 2: 5′‐GCUGGUGGCACUUUACUUATT‐3′ or nontargeting siRNA) using RNAi‐Mate (GenePharma) according to the manufacturer's protocol. The MET‐overexpression lentivirus (OE‐MET) was purchased from (GenePharma). LNCaP and 22RV1 cells were transduced with the lentivirus in the presence of polybrene (8 μg/ml), after that, those successfully transfected cells were selected with puromycin (2 μg/ml).
+ Open protocol
+ Expand
9

Transfection of JEG-3 Cells with siRNA and Plasmids

Check if the same lab product or an alternative is used in the 5 most similar protocols
JEG-3 cells were transfected with siRNA (chemically synthesized by Shanghai GenePharma, Shanghai, China) using RNAi-Mate (Shanghai GenePharma, Shanghai, China) following the manufacturer's protocol. The sequences of the siRNAs are available in Table 1. In the plasmid transfection experiments, JEG-3 cells were transfected with pCMV5 TBRI-HA (Addgene Plasmid 19162), CS2 Flag-Smad3 (EPSM) (Addgene Plasmid 14963), or the empty vector pCMV5 (Addgene) served as negative control using Lipofectamine 2000 (Invitrogen, Inc. Carlsbad,CA) according to the manufacturer's instructions. The time when transfection commenced was considered as time 0. After incubation in medium containing transfection reagent for 6h, the media were changed into normal growth medium. The cells were allowed to be recovered for 48 h, and then subjected to TGF-β1 or SB431542 treatment, mRNA quantification, protein analysis or invasion assay.
+ Open protocol
+ Expand
10

Lentiviral Knockdown of NEK6 in 293T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
A lentivirus-based NEK6-homo-657 RNA plasmid (shNEK6) and an NC-shRNA plasmid were constructed (GenePharma, Shanghai, China). The NEK6 gene was cloned in LV3 (H1/GFP&Puro) plasmids. LV3-NEK6-homo-657 and LV3-shNC plasmids were transfected into 293T cells using RNAi-mate (GenePharma) according to the manufacture's protocol. The cells were harvested 72h after transfection and stable cells were selected and detected by Fluorescence microscope (Motic, China).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!