Cdna high capacity cdna reverse transcription kit

Manufactured by Thermo Fisher Scientific

Sourced in United States

The CDNA High-Capacity cDNA Reverse Transcription Kit is a laboratory tool designed for the reverse transcription of RNA into complementary DNA (cDNA). It provides a reliable and efficient method for generating high-quality cDNA from various RNA sources.

Automatically generated - may contain errors

Lab products found in correlation

Tri reagent, by Thermo Fisher Scientific (2 mentions) Quantstudio 5, by Thermo Fisher Scientific (2 mentions) Rneasy mini kit, by Qiagen (1 mentions) Lightcycler 480 2, by Roche (1 mentions) Faststart essential dna green master, by Roche (1 mentions) Innuprep rna mini kit, by Analytik Jena (1 mentions) Rq1 dnase, by Promega (1 mentions) Faststart essential dna green master mix, by Roche (1 mentions) Sybr green jumpstart taq readymix, by Merck Group (1 mentions) Rq1 rnase, by Promega (1 mentions) Total rna mini kit, by A&A Biotechnology (1 mentions) Lightcyclerr 480 real time pcr system, by Roche (1 mentions) Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions) Magnetic cell sorting system, by Miltenyi Biotec (1 mentions) Taqman universal pcr master mix, by Thermo Fisher Scientific (1 mentions) Taqman probe, by Thermo Fisher Scientific (1 mentions) Sybr green qpcr master mix, by Bioneer (1 mentions) Cfx96 touch, by Bio-Rad (1 mentions)

8 protocols using cdna high capacity cdna reverse transcription kit

Quantitative RT-PCR Analysis of Kidney Biomarkers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from kidney tissue using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. RNA was reverse transcribed using the cDNA High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). Quantitative RT-PCR was performed using FastStart Essential DNA Green Master (Roche, Basel, Switzerland) in a 10 µL total reaction volume on a LightCycler^® 480 II instrument (Roche, Basel, Switzerland) at optimized thermocycling settings. Relative gene expression was normalized to ribosomal 36b4 (RPLP0) as a housekeeping gene, evaluated using the 2^−ΔΔCt method and reported as fold change. The sequences (5′–3′) of the primers used were as follows: Klotho-Forward primer TGTGACTTTGCTTGGGGAGTT and reverse primer TCTTCTTGGCTACAACCCCG; KIM-1-Forward primer AGGCGCTGTGGATTCTTATG and reverse primer AAGCAGAAGATGGGCATTGC; NGAL-Forward primer GGCCAGTTCACTCTGGGAAA and reverse primer TGGCGAACTGGTTGTAGTCC; RPLP0-Forward primer AGATGCAGCAGATCCGCAT and reverse primer GTTCTTGCCCATCAGCACC.

González-Lafuente L., Navarro-García J.A., Valero-Almazán Á., Rodríguez-Sánchez E., Vázquez-Sánchez S., Mercado-García E., Pineros P., Poveda J., Fernández-Velasco M., Kuro-O M., Ruilope L.M, & Ruiz-Hurtado G. (2023). Partial Genetic Deletion of Klotho Aggravates Cardiac Calcium Mishandling in Acute Kidney Injury. International Journal of Molecular Sciences, 24(2), 1322.

+ Open protocol

+ Expand

Transcriptome Analysis of Tannerella forsythia

Check if the same lab product or an alternative is used in the 5 most similar protocols

T. forsythia RNA was isolated from 5-day-old plates using an innuPREP RNA Mini Kit (Analytic Jena, Jena, Germany). Before cDNA synthesis, the RNA was digested with RQ1 DNase (Promega, Madison, WI, USA) and purified using the TRI Reagent (Ambion, Life Technologies). RNA (1.6 μg) was then reverse transcribed with cDNA High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Life Technologies). The real-time PCR was performed on a CFX96 Touch machine. A single reaction consisted of 7.5 μl of FastStart Essential DNA Green Master mix (Roche, Basel, Switzerland), 1 μl of 300 nM target specific primer mix (Supplementary Table 1), 5 μl of cDNA (diluted 1:10), and 1.5 μl of water. The PCR reaction consisted of an initial denaturation step at 95°C for 10 min, followed by 40 cycles of 10 s at 95°C, 30 s at a primer specific annealing temperature, and 30 s at 72°C. All samples were analyzed in triplicate. Relative transcripts levels were calculated using the modified ΔΔCt method (Pfaffl, 2001 (link)).

Ksiazek M., Mizgalska D., Eick S., Thøgersen I.B., Enghild J.J, & Potempa J. (2015). KLIKK proteases of Tannerella forsythia: putative virulence factors with a unique domain structure. Frontiers in Microbiology, 6, 312.

+ Open protocol

+ Expand

Quantitative Analysis of S. aureus Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from S. aureus infected hMDMs using the Total RNA mini kit (A&A biotechnology). Bacterial cells were mechanically disrupted with FastPrep-FP120 Instrument (Savant Bio101). Before cDNA synthesis, RNA was digested with RQ1 RNase (Promega) and repurified with the TRI Reagent (Ambion, Life Technologies). Next RNA (0.85 µg) was reverse transcribed using the cDNA High Capacity cDNA Reverse Transcription Kit (Applied biosystems, Life Technologies). Transcript levels were analyzed with target specific primers, for hla: hlaFor- ATTTGCACCAATAAGGCCGC and hlaRev- TGGTTTAGCCTGGCCTTCAG and for 16S rRNA: 16SFor- GCTGCCCTTTGTATTGTC and 16SRev- AGATGTTGGGTTAAGTCCC. Real time PCR was performed using a CFX96 Touch machine. Reaction mixtures consisted of 7.5 µl of SYBR Green JumpStart Taq ReadyMix (Sigma- Aldrich), 1 µl of 300 nM of primers mix, 5 µl of 10 times diluted cDNA and 1.5 µl water. PCR parameters were: an initial denaturation step at 94°C for 3 min, followed by 40 cycles of 10 s at 94°C, 20 s at 55 °C and 45 s at 72°C. All samples were analyzed in triplicate. Relative transcripts levels were calculated using the modified ΔΔCt method [14 (link)]. PCR reactions to confirm a lack of contamination with genomic DNA were performed on RNA samples not subject to reverse transcription, using an identical protocol as for quantitative PCR.

Koziel J., Chmiest D., Bryzek D., Kmiecik K., Mizgalska D., Maciag-Gudowska A., Shaw L.N, & Potempa J. (2014). The Janus Face of a-Toxin: A Potent Mediator of Cytoprotection in Staphylococci-Infected Macrophages. Journal of Innate Immunity, 7(2), 187-198.

+ Open protocol

+ Expand

RT-PCR Analysis of Immune Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

We then selected the following markers for RT-PCR confirmation of mRNA expression levels: IL1R1, TLR2, TLR4, IL1T2, ARG1, and TLR5. All mRNA samples were first transformed into cDNA according to manufacturer instructions (cDNA-High Capacity cDNA Reverse Transcription kit, Applied Biosystems, Cat. 4368813). Samples were then prepared by adding 2.5 ng/μL of cDNA with 0.2 μL each of forward and reverse primers (10 μM) and 5 μL of SYBR Green PCR Master Mix (ABI, Cat. 4367659) before performing quantitative RT-PCR on the LightCycler R 480 Real-Time PCR System (Roche Molecular Systems, Inc. Indiana, USA). 18S was used as an internal control. IL1R1—Forward (F) AAAGATGACAGCAAGACACCTG, Reverse (R):GTTTGCAATCCTTACCACGCAA; TLR2—(F): GAGTTCTCCCAGTGTTTGGTGT (R):CACACCATCAGAACCCTGTC; IL1R2—(F):ATGACACCCACATAGAGAGCG (R):GAAGAGCGAAACCCACAGAGT; ARG1—(F):ACTTAAAGAACAAGAGTGTGATGTG (R) CGCTTGCTTTTCCCACAGAC; TLR5—(F):TGCTACTGACAACGTGGCTT (R):CCAGGAAAGCTGGGCAACTA; TLR4—(F):ATGCCAGGATGATGTCTGCC (R):TGGATTTCACACCTCCACGC; 18S—(F):GTAACCCGTTGAACCCCATT (R):CCATCCAATCGGTAGTAGCG. We then calculated the relative quantification of mRNA expression levels by using the comparative threshold cycle (CT) method (i.e., by comparing the RT-PCR cycle number required to reach target fluorescence) by using the following equation: 2^{−(ΔCTtarget−ΔCTcalibrator)}, also known as 2^−ΔΔCT.

Guo M.M., Chang L.S., Huang Y.H., Wang F.S, & Kuo H.C. (2020). Epigenetic Regulation of Macrophage Marker Expression Profiles in Kawasaki Disease. Frontiers in Pediatrics, 8, 129.

+ Open protocol

+ Expand

Monocyte Gene Expression Analysis

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

To detect expression of inflammation-related genes in CD14 + monocytes, collection, purification and determination methods were used as described in previous publications^{14 (link),17 (link)}. Shortly, RNA was isolated from CD14 + purified monocytes; to obtain cDNA for quantitative-polymerase chain reaction (q-PCR), 1 μg of RNA was reverse-transcribed using the cDNA high-capacity cDNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA, USA). Then, relative to the housekeeping gene ABL1, the expression of the genes ADM, ATF3, BCL2A1, BTG3, CCL2, CCL20, CCL7, CD9, CDC42, CXCL2, DHRS3, DUSP2, EMP1, EREG, FABP5, HSPA1A/HSPA1B, IL-1α, IL-1β, IL1R1, IL-6, IRAK2, MAFF, MAPK6, MXD1, NAB2, PDE4B, PTGS2, PTPN7, PTX3, SERPINB2, STX1A, THBD, TNF and TNFAIP3 was determined, using the comparative threshold cycle (CT) method (Biosystems, 2001), yielding ΔCT values. Due to minor technical differences in leukocyte isolation procedures, we expressed patient data relative to values of controls of the same site by deriving ΔΔCT values before pooling data^{29 (link)}. Complete control cases without CA were used as reference group. Data are deposited in the NCBI’s GEO repository (accession number GSE147582-GSE147584).

Schiweck C., Claes S., Van Oudenhove L., Lafit G., Vaessen T., de Beeck G.O., Berghmans R., Wijkhuijs A., Müller N., Arolt V., Drexhage H, & Vrieze E. (2020). Childhood trauma, suicide risk and inflammatory phenotypes of depression: insights from monocyte gene expression. Translational Psychiatry, 10, 296.

+ Open protocol

+ Expand

Monocyte Gene Expression Analysis in Psychiatric and Metabolic Disorders

Cited 4 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

CD14⁺ monocytes were isolated from the frozen PBMCs using a magnetic cell sorting system (Miltenyi Biotec, Germany) resulting in a purity of monocytes >95%. RNA was isolated from the purified monocytes, and 1 μg of RNA was reverse transcribed using the cDNA high-capacity cDNA Reverse Transcription Kit (Applied Biosystems, Carlsbad, CA, USA). The cDNA was used in quantitative polymerase chain reaction (qPCR) to determine gene expression using the comparative threshold (CT) cycle method (32 ). qPCR was performed using a TaqMan Universal PCR mastermix and TaqMan probes (Applied Biosystems). Gene expression was normalized to expression of housekeeping gene ABL1, and the resulting ΔCT values were used for further analyses.
Genes of interest were selected based on previous findings of abnormally expressed genes in patients with BD (4 (link), 5 (link), 11 (link)), MDD (31 (link)), type 2 diabetes (23 (link)), and systemic autoimmune diseases [the IFN-induced inflammatory genes (33 (link))], and known to be involved in major inflammatory or immune activation pathways in monocytes and macrophages. We selected the most consistently over expressed genes. A list of included genes is given in Table S1 in Supplementary Material.

Vogels R.J., Koenders M.A., van Rossum E.F., Spijker A.T, & Drexhage H.A. (2017). T Cell Deficits and Overexpression of Hepatocyte Growth Factor in Anti-inflammatory Circulating Monocytes of Middle-Aged Patients with Bipolar Disorder Characterized by a High Prevalence of the Metabolic Syndrome. Frontiers in Psychiatry, 8, 34.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from tissues using TRIzol reagent according to the manufacturer’s instructions. cDNA was reverse transcribed from 1 μg of RNA using the cDNA High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Quantitative PCR (qPCR) was performed with SYBR green qPCR master mix (AccuPower 2X, Bioneer) using QuantStudio 5 (Applied Biosystems). The relative amount of mRNA normalized to cyclophilin B was calculated using the delta–delta method. Primer sequences are listed in Table S2.

Jung B.C., You D., Lee I., Li D., Schill R.L., Ma K., Pi A., Song Z., Mu W.C., Wang T., MacDougald O.A., Banks A.S, & Kang S. (2023). TET3 plays a critical role in white adipose development and diet-induced remodeling. Cell reports, 42(10), 113196.

+ Open protocol

+ Expand

Quantification of Gene Expression by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from tissues using TRIzol reagent according to the manufacturer's instructions. cDNA was reverse transcribed from 1 mg of RNA using the cDNA High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Quantitative PCR (qPCR) was performed with SYBR Green qPCR Master Mix (AccuPower 2X; Bioneer Corporation) using a CFX96 Touch (Bio-Rad Laboratories) or QuantStudio 5 (Applied Biosystems). The relative amount of mRNA normalized to cyclophilin B was calculated using the delta-delta method. Primer sequences are listed in Supplementary Table 2.

You D., Chul Jung B., Villivalam S.D., Lim H.W, & Kang S. (2021). JMJD8 is a Novel Molecular Nexus Between Adipocyte-Intrinsic Inflammation and Insulin Resistance. Diabetes.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!