Reverse transcription kit

Total RNA was extracted from tissue samples and RASFs using Qiagen miRNeasy Mini kit (Qiagen GmbH), according to the manufacturer's protocol. The cDNAs were synthesized depending on total RNA and a reverse transcription kit (Abcam, Canada). The reverse transcription protocol was as follows: 25˚C for 5 min, 55˚C for 15 min and 85˚C for 5 min. The amplification of cDNAs was performed using a SYBR^®-Green Master mix kit (Qiagen GmbH) on an Applied Biosystems 7500 Real-Time PCR system (Thermo Fisher Scientific, Inc.). The primers were as follows: miR-27a-3p forward, 5'-ACACTCCAGCTGGGTTCACAGTG GCTAAG-3' and reverse, 5'-AGGGCTTAGCTGCTTGTGA GCA-3'; TLR5 forward, 5'-TGCCACTGTTGAGTGCAAGTC-3' and reverse, 5'-ACCTGGAGAAGCCGAAGGTAA-3'; GAPDH forward, 5'-GACAGTCAGCCGCATCTTCT-3' and reverse, 5'-GCGCCCAATACGACCAAA-3'; U6 forward, 5'-GCTTCGGCAGCACATATACTAAAAT-3' and reverse, 5'-CGCTTCACGAATTTGCGTGTCAT-3'. The thermocycling conditions used were 95˚C for 10 min, followed by 40 cycles of 95˚C for 15 sec, 60˚C for 30 sec and 60˚C for 15 sec. The reaction was held at 74˚C for continuous for melting curve analysis. The relative expression levels of miR-27a-3p and TLR5 mRNA were calculated by 2^-ΔΔCT methods (24 (link)) with normalization to U6 small nuclear RNA (U6) and GAPDH, respectively. All PCR reactions were performed in triplicate.

Total RNA from cartilage tissues and LPS‐treated primary chondrocytes was isolated using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). A reverse transcription kit (Abcam) and the SYBR Green Master Mix Kit (Qiagen, Hilden, Germany) were used to amplify special gene expression on the Applied Biosystems 7500 Real‐Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). The expression level of DANCR and miR‐19a were calculated using comparative threshold cycle value (2^−ΔΔCt) method, compared with glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) and U6 small nuclear RNA (U6), respectively. Polymerase chain reaction (PCR) primers were as follows: DANCR:¹⁷ 5′‐GCGCCACTATGTAGCGGGTT‐3′ (sense) and 5′‐TCAATGGCTTGTGCCTGTAGTT‐3′ (antisense); U6: 5′‐CTCGCTTCGGCAGCACA‐3′ (sense) and 5′‐AACGCTTCACGAATTTGCGT‐3′ (antisense); GAPDH: 5′‐AAGAAGGTGGTGAAGCAGGC‐3′ (sense) and 5′‐TCCACCACCCTGTTGCTGTA‐3′ (antisense). The primers for miRNA‐19a‐3p (miR‐19a) were purchased from Qiagen. All experiments were performed in at least three wells, and relative gene expression was normalized to control groups (as unit 1).