Log In Sign up
The largest database of trusted experimental protocols

Superscript vilo first strand synthesis system

Manufactured by Thermo Fisher Scientific
Visit Supplier

The Superscript Vilo First-Strand Synthesis System is a laboratory equipment used for the conversion of RNA to complementary DNA (cDNA). It provides a streamlined, easy-to-use solution for first-strand cDNA synthesis from total RNA or poly(A)+ RNA.

Automatically generated - may contain errors

Lab products found in correlation

Dynabeads mrna purification kit, by Thermo Fisher Scientific (5 mentions) Dna ligase, by Thermo Fisher Scientific (5 mentions) Rneasy plus mini kit, by Qiagen (5 mentions) Rnase h, by Thermo Fisher Scientific (3 mentions) E coli dna polymerase 1, by Thermo Fisher Scientific (2 mentions) Powertrack sybr green master mix, by Thermo Fisher Scientific (1 mentions) Quantstudio 5, by Thermo Fisher Scientific (1 mentions)

6 protocols using superscript vilo first strand synthesis system

1

Plasma Cell Transcriptome Profiling

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasma cells (CD138+GFP+) were sorted from the bone marrow as described in Fig. S3 A, and plasmablasts were isolated by flow-cytometric sorting as CD22–CD138+GFP+ cells after 4 d of LPS stimulation of B cells from the spleen and lymph nodes. Total RNA from in vitro stimulated plasmablasts or ex vivo sorted plasma cells was isolated with the RNeasy Plus Mini Kit (Qiagen), and mRNA was purified by two rounds of poly(A) selection with the Dynabeads mRNA purification kit (Invitrogen). The mRNA was fragmented by heating at 94°C for 3 min in fragmentation buffer. The fragmented mRNA was used as template for first-strand cDNA synthesis with random hexamers and the Superscript Vilo First-Strand Synthesis System (Invitrogen). The second-strand cDNA synthesis was performed with 100 mM deoxy ATP (dATP), dCTP, dGTP, and dUTP in the presence of RNase H, Escherichia coli DNA polymerase I, and DNA ligase (Invitrogen). The incorporation of dUTP allowed for specific elimination of the second DNA strand during library preparation, thereby preserving strand specificity (Parkhomchuk et al., 2009 (link)).
Liu G.J., Jaritz M., Wöhner M., Agerer B., Bergthaler A., Malin S.G, & Busslinger M. (2020). Repression of the B cell identity factor Pax5 is not required for plasma cell development. The Journal of Experimental Medicine, 217(11), e20200147.
+ Open protocol
+ Expand
2

RNA-Seq Library Preparation from Sorted Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from ex vivo sorted pro-B and pre-B cells or short-term in vitro expanded pro-B cells was isolated with the RNeasy Plus Mini Kit (Qiagen), and mRNA was purified by two rounds of poly(A) selection with the Dynabeads mRNA purification kit (Invitrogen). The mRNA was fragmented by heating at 94 °C for 3 min in fragmentation buffer. The fragmented mRNA was used as template for first-strand cDNA synthesis with random hexamers and the Superscript Vilo First-Strand Synthesis System (Invitrogen). The second-strand cDNA synthesis was performed with 100 mM dATP, dCTP, dGTP and dUTP in the presence of RNase H, E. coli DNA polymerase I and DNA ligase (Invitrogen).
Hill L., Ebert A., Jaritz M., Wutz G., Nagasaka K., Tagoh H., Kostanova-Poliakova D., Schindler K., Sun Q., Bönelt P., Fischer M., Peters J.M, & Busslinger M. (2020). Wapl repression by Pax5 promotes V gene recombination by Igh loop extrusion. Nature, 584(7819), 142-147.
+ Open protocol
+ Expand
3

Immature B Cell RNA Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA from ex vivo‐sorted immature B cells was isolated with the RNeasy Plus Mini Kit (Qiagen). mRNA was obtained by two rounds of poly(A) selection using the Dynabeads mRNA purification kit (Invitrogen) and fragmented by heating at 94°C for 3 min in fragmentation buffer. The fragmented mRNA was used as a template for first‐strand cDNA synthesis with random hexamers using the Superscript Vilo First‐Strand Synthesis System (Invitrogen). The second‐strand cDNA was synthesized with 100 mM dATP, dCTP, dGTP, and dUTP in the presence of RNase H, E. coli DNA polymerase I, and DNA ligase (Invitrogen).
Hill L., Jaritz M., Tagoh H., Schindler K., Kostanova‐Poliakova D., Sun Q., Schwickert T.A., Leeb M, & Busslinger M. (2023). Enhancers of the PAIR4 regulatory module promote distal VH gene recombination at the Igh locus. The EMBO Journal, 42(15), e112741.
+ Open protocol
+ Expand
4

RNA-Seq of B cell differentiation

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA from LPS-differentiated activated B cells, pre-plasmablasts and plasmablasts as well as ex vivo sorted lymph node B cells and bone marrow plasma cells was isolated with the RNeasy Plus Mini Kit (Qiagen), and mRNA was obtained by two rounds of poly(A) selection using the Dynabeads mRNA purification kit (Invitrogen) followed by fragmentation by heating at 94°C for 3 min (in fragmentation buffer). The fragmented mRNA was used as template for first-strand cDNA synthesis with random hexamers using the Superscript Vilo First-Strand Synthesis System (Invitrogen). The second-strand cDNA was synthesized with 100 mM dATP, dCTP, dGTP and dUTP in the presence of RNase H, E. coli DNA polymerase I and DNA ligase (Invitrogen). The incorporation of dUTP allowed elimination of the second strand during library preparation (see below), thereby preserving strand specificity15 .
Minnich M., Tagoh H., Bönelt P., Axelsson E., Fischer M., Cebolla B., Tarakhovsky A., Nutt S.L., Jaritz M, & Busslinger M. (2016). Multifunctional role of the transcription factor Blimp1 in coordinating plasma cell differentiation. Nature immunology, 17(3), 331-343.
+ Open protocol
+ Expand
5

Quantitative RT-PCR for Metabolic Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Reverse Transcriptase quantitative PCR (RT-qPCR) was performed using the SuperScript VILO First-Strand Synthesis System (Invitrogen). For each sample, >500 ng of total RNA was used for cDNA synthesis. In each qPCR reaction, 1–4 ng cDNA was combined with PowerTrack SYBR Green Master Mix (ThermoFisher) and primer pairs. All primer pairs were validated for ≥1.8 amplification efficiency. Samples were run on a ThermoFisher QuantStudio 5 real-time PCR system in triplicate, and log2 fold change was determined by normalizing the delta-delta CT to the internal reference gene Beta Actin. Primers were designed using Primer3plus. Primer sets used; Slc2a1 F: acttgccttctttgccaagc R: aaagcctcctagctcagagttc; Ldha F: aactgcaggcttcgattacc R: tgcatcatggacgtacacac; Vegfa F: acacgacaaacccattcctg R: tccacaaagcatgccatgtc; Aldoa F: ctgaataggctgcgttctcttg R: aaggactaaggagcgaacgc; Pdk1 F: atgctggctggttttgatgc R: ttcagtcaccccgaaaatgc; Pfkl F: ggacaaaccgggtacacagg R: atccgcagtttctccaggtc; Pfkfb3 F: gcatccctgagcttttgaacag R: aatgtgctttgtgcggagtc; Slc16a4 F: tggttgtttccaccaagcag, R: taggctacatgcggagatcac; Actb F: tttggcgcttttgactcagg R: actttgggggatgtttgctc.
Buth J.E., Dyevich C.E., Rubin A., Wang C., Gao L., Marks T., Harrison M.R., Kong J.H., Ross M.E., Novitch B.G, & Pearson C.A. (2024). Foxp1 suppresses cortical angiogenesis and attenuates HIF-1alpha signaling to promote neural progenitor cell maintenance. EMBO Reports, 25(5), 2202-2219.
+ Open protocol
+ Expand
6

Strand-specific RNA-seq Library Preparation

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from ex vivo sorted or in vitro stimulated FO B cells was isolated with the RNeasy Plus Mini Kit (Qiagen), and mRNA was purified by two rounds of poly(A) selection with the Dynabeads mRNA purification kit (Invitrogen). The mRNA was fragmented by heating at 94 °C for 3 min in fragmentation buffer. The fragmented mRNA was used as template for first-strand cDNA synthesis with random hexamers and the Superscript Vilo First-Strand Synthesis System (Invitrogen). The second-strand cDNA synthesis was performed with 100 mM dATP, dCTP, dGTP and dUTP in the presence of RNase H, E. coli DNA polymerase I and DNA ligase (Invitrogen). The incorporation of dUTP allowed for specific elimination of the second DNA strand during library preparation, thereby preserving strand specificity60 (link).
Schwickert T.A., Tagoh H., Schindler K., Fischer M., Jaritz M, & Busslinger M. (2019). Ikaros prevents autoimmunity by controlling anergy and Toll-like receptor signaling in B cells. Nature immunology, 20(11), 1517-1529.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!