Labopass m mulv reverse transcriptase

Total RNA was extracted from homogenized colon tissue or cPBMC-derived macrophages using the Easy-BLUE Total RNA Extraction kit (Intron Biotechnology) according to the manufacturer’s instructions. cDNA was synthesized using LaboPass M-MuLV Reverse Transcriptase (Cosmo Genetech, Seoul, Korea) and the samples were analyzed using 10 μL AMPIGENE qPCR Green Mix Hi-ROX with SYBR Green dye (Enzo Life Sciences, Farmingdale, NY, USA) and 400 nM forward and reverse primers (Cosmo Genetech). Expression levels of the target genes were normalized to that of glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Primer sequences used in the present study are listed in Additional file 5: Table S1.

Standard curves for evaluating the migratory ability of intraperitoneally injected canine MSCs were generated by administering serial dilutions of cAT-MSCs to mouse organs as described previously [25 (link)]. Briefly, 2 × 10², 2 × 10³, 2 × 10⁴, or 2 × 10⁵ cAT-MSCs were added to whole mouse organs prior to homogenization. Total RNA was extracted from the samples using the Easy-BLUE Total RNA Extraction kit (Intron Biotechnology), and cDNA was synthesized (LaboPass M-MuLV Reverse Transcriptase; Cosmo Genetech) using 1 μg of RNA. Next, qRT-PCR using canine-specific mitochondrial cytochrome b primers (forward primer, 5′-CCT TAC TAG GAG TAT GCT TG-3′; reverse primer, 5′-TGG GTG ACT GAT GAA AAA G-3′) was performed to generate the standard curves. The curves were corrected by performing parallel qRT-PCR with primers for universal eukaryotic 18S ribosomal RNA (forward primer, 5′-GCT ACT ACC GAT TGG ATG GTT TAG-3′; reverse primer, 5′-CTA CGG AAA CCT TGT TAC GAC TTT-3′).

Total RNA was extracted from homogenised colon tissue or Raw 264.7 cells using the Easy-BLUE Total RNA Extraction kit (Intron Biotechnology, Seongnam, Korea) according to the manufacturer’s instructions. cDNA was synthesised using LaboPass M-MuLV Reverse Transcriptase (Cosmo Genetech, Seoul, Korea) and the samples were analysed in duplicate using 10 µL of AMPIGENE qPCR Green Mix Hi-ROX with SYBR Green dye (Enzo Life Sciences, Farmingdale, NY, USA) and 400 nM forward and reverse primers (Cosmo Genetech). Expression levels of the target genes were normalised to that of glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Primer sequences used in this study are listed in Supplementary Table S2.

Total RNA was extracted from all groups using the Easy-BLUE Total RNA Extraction kit (Intron Biotechnology, Seongnam, Korea) according to the manufacturer’s instructions. cDNA was synthesized from 1 μg of total RNA with LaboPass M-MuLV Reverse Transcriptase (Cosmo Genetech, Seoul, Korea) and the samples were analyzed in triplicates using AMPIGENE qPCR Green Mix Hi-ROX with SYBR Green dye (Enzo Life Sciences, Farmingdale, NY, USA). The expressions of target genes were analyzed according to the 2^−ΔΔ/Cts method and normalized to mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Primer sequences used in this study are listed in Table 1.Table 1

List of primer for qRT-PCR

Gene	Forward (5′-3′)	Reverse (5′-3′)
GAPDH	AGTATGTCGTGGAGTCTACTGGTGT	AGTGAGTTGTCATATTTCTCGTGGT
GLUT4	CCCAGTGAGTCTGTCATCTAGTAGT	GGACTAGAACCATACTCATCAGAAG
IRS-1	GAACACTGGTCCTAGCTGTATTCTC	GTAGCTCTGTTCAATCACCTTCTGT