The largest database of trusted experimental protocols

18 protocols using lentiviral particles

1

Modulating TUG1 and BDNF in Neuronal Hypoxia

Check if the same lab product or an alternative is used in the 5 most similar protocols
The sh-TUG1, sh-BDNF, and control shRNA (GenePharma) were constructed into a lentiviral vector and then packaged into lentiviral particles (GenePharma). HT22 cells were infected with the lentivirus (5 × 105 TU per 24-well plate) for 72 h before OGD treatment. The shRNA sequences were shown as follows:
sh-NC: sense 5′-UUCUCCGAACGUGUCACGUTT-3′, antisense 3′-ACGUGACAC GUUCGGAGAATT-5′.
sh-TUG1: sense 5′-CCAUCUCACAAGGCUUCAATT-3′, antisense 3′-TTGGUAG AGUGUUCCGAAGUU-5′.
sh-BDNF: sense 5′-GGTGATGCTCAGCAGTCAAGT-3′, antisense 3′-CCACTACG AGTCGTCAGTTCA-5′.
+ Open protocol
+ Expand
2

Silencing Regulatory Genes in Single Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The medium was replaced before transduction for 1 h. ShRNA against CD96, Src, Stat3, Opa1, or GFP (as a control) was transduced into single cells by 5 × 107 lentiviral particles (multiplicity of infection of 10, Genepharma) supplemented with 8 µg mL−1 Polybrene (Sigma) for 8–12 h. The silenced efficiency was evaluated by western blot after transduction 2 days. For plasmid transfection, opti‐MEN medium was mixed with plasmid (Genepharma, Shanghai) and Lipofectamine 3000 (Cat# L3000015, Thermo) respectively. LP‐300 was added at a 1:2 ratio to the plasmid, which was added into cells after 5 min. Cells were incubated for 12 h and the medium was changed. Protein expression was detected by western blotting after 2 days. The sequences as follow:
Sh‐GFP: TAGCGACTAAACACATCAA;
Sh‐CD96‐1: CCAACGAAAGTGATCTGCC;
Sh‐CD96‐2: AGTGGAAGGTACGAGTGTA;
Sh‐Src‐1: GCTCGGCTCATTGAAGACA;
Sh‐Src‐2: GACAGACCTGTCCTTCAAG;
Sh‐Stat3‐1; GCAAAGAATCACATGCCAC;
Sh‐Stat3‐2; GCACAATCTACGAAGAATC;
Sh‐Opa1‐1: GCCTGACATTGTGTGGGAAAT;
Sh‐Opa1‐2: GCTCCTGACACAAAGGAAACT;
+ Open protocol
+ Expand
3

Establishment of β-catenin Knockdown Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
β-catenin lentiviral siRNA plasmid (pGLV5-CTNNB1) and scrambled siRNA plasmid (pGLV5-NC) were acquired from Vipotion Biotechnology (Guangzhou, China). MKN45/R and NCI N87/R cell lines with β-catenin knockdown were established by infection of high titer lentiviral particles from GenePharma (Shanghai, China). Briefly, 293T cells were cultured in 6 cm plates with antibiotic-free media. When the confluence reached about 70%, cells were co-transfected with 2 μg packaging plasmid and 10 μg of siRNA plasmid mixed with lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. After incubation for 48 h, supernatants containing virus particles were collected by centrifugation. Target cells were transduced with virus particles by plating 1 × 105 cells/well in a 6-well plate. Knockdown efficiency was assessed by RT-PCR and Western blot. Stable cell lines with β-catenin knockdown were used in the subsequent study.
+ Open protocol
+ Expand
4

Modulating miR-155 Expression in MCAO Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
To modify the expression of miR-155 in the mouse model, purified lentiviral particles containing miR-155+/+ or miR-155−/− were obtained from Shanghai GenePharma Co., Ltd. (Shanghai, China). The sequences were as follows: miR-155+/+: 3′-UGGGCAUAGUCCUAAUCGUAAUU-5′; miR-155−/−: 3′-UGCAUAUAAUGCUAAAGCAUUAA-5′; control miRNA: 3′-UAAACAUGUACGCAUGCAUAGCU-5′. Prior to administration, mice were anesthetized and fixed on a stereotactic frame, lentivirus constructs (miR-155+/+, miR-155−/− and scrambled control; 109 TU/ml) were mixed with the cationic lipid Polybrene (4 µg/µl; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) and incubated at 37°C for 15 min. Subsequently, each mouse was slowly administered 7 µl mixture over 20 min via right intracerebroventricular injection. At 14 days following viral vector injection, MCAO procedure was performed on these mice.
+ Open protocol
+ Expand
5

Silencing Pdk1 and Pdk2 in PASMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
For Pdk1 and Pdk2 double silencing, PASMCs at 50%–70% confluence were transduced with lentiviral particles (GenePharma) that packaged Pdk1 shRNA (5′-GGTTTATGTTCCGTCCCATCT-3′) or scramble shRNA (5′-TTCTCCGAACGTGTCACGT-3′) (LV10N, MOI = 50) and Pdk2 shRNA (5′-GCTGTCCATGAAGCAGTTTCT-3′) or scramble shRNA (5′-TTCTCCGAACGTGTCACGT-3′) (LV3, MOI = 60) in the presence of 6 μg/ml polybrene. After transduction for 72 h, PASMCs were selected with puromycin (2 μg/ml). The efficacy of Pdk1&2 silencing was evaluated by immunoblots or real-time quantitative PCR (RT-qPCR).
+ Open protocol
+ Expand
6

In Vivo Tumor Growth Assay in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
BALB/c nude mice were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. (male, 6 weeks old, 18-20 g). Animal experiments were approved by the Institute of Basic Medicine, Shandong First Medical University & Shandong Academy of Medical Sciences and were performed according to the established guidelines. Mice were fed under the condition of specific pathogen-free. shERCC6L and NC were used to construct lentiviral particles (GenePharma), and the lentivirus were infection to establish stable transfected cells. Mice were randomly grouped two groups (with 7 mice each group): negative control group (NC group, injected with SMMC7721 transfected with NC) and shERCC6L group (injected with SMMC7721 transfected with shERCC6L). A total of 1 × 107 cells were suspended in 100 μL serum-free DMEM and injected subcutaneously into the right back of mice. After injection, the long diameter (L), width diameter (W) of tumors were measured every 5 days, and the volumes of tumor were calculated as following Volume (V) = (W2 × L)/2. Mice were anaesthetized by intraperioneal injection of pentobarbital sodium overdose (100 mg/kg) on the 30th day. Euthanasia was considered to be successful if there was cardiac arrest and no spontaneous breath for 3 min, and then tumors were taken out and weighed.
+ Open protocol
+ Expand
7

ALKBH5 Knockdown and Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentivirus expressing scramble or ALKBH5 shRNAs was purchased from GenePharma Company. In the case of knockdown experiments, cells were infected these lentiviral particles and selected with 3 μg/ml puromycin. In the case of overexpression experiments, cells were infected with lentiviral particles expressing empty vector control or ALKBH5 (GenePharma Company) and selected with 3 μg/ml puromycin.
+ Open protocol
+ Expand
8

Knockdown of PKR and STAT3 in HepG2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Short hairpin RNA (shRNA) sequences were obtained from Public TRC Portal (Broad Institute, Cambridge, MA, USA) and lentiviruses expressing the shRNA sequences were synthesized by Shanghai GenePharma Co., Ltd., (Shanghai, China). Polybrene and puromyocin were purchased from Sigma-Aldrich (St. Louis, MO, USA). Transfection of the HepG2 cells with lentiviral particles (Shanghai GenePharma Co., Ltd.)was conducted as described previously (23 (link)). Titration of the lentiviruses was performed (not shown), and the lowest functional quantities of the virus (MOI=5) and Polybrene were subsequently applied in the LOF experiments. The shRNA target sequences for PKR were as follows: shPKR-1, 5′-GCTGAACTTCTTCATGTATGT-3′ and shPKR-2, 5′-GAGGCGAGAAACTAGACAAAG-3′. The shRNA target sequence for STAT3 was 5′-GCACAATCTACGAAGAATCAA-3′.
+ Open protocol
+ Expand
9

Overexpression and Knockdown of CDC37L1

Check if the same lab product or an alternative is used in the 5 most similar protocols
LV-CDC37L1 and LV-NC (negative control) for overexpression of CDC37L1; LV-shCDC37L1 and LV-shNC (negative control) for knockdown of CDC37L1; Two kinds of lentiviral particles were packaged and purchased from GenePharma (Shanghai, China). Stable cell lines were established by puromycin selection after lentivirus transduction.
+ Open protocol
+ Expand
10

Generating Cells for ARV7 and UBE2C Studies

Check if the same lab product or an alternative is used in the 5 most similar protocols
For generating cells stably expressing ARV7 or cells with ARV7 depletion, lentiviral particles were synthesized by GenePharm, and infected cells were selected using puromycin as the protocol recommended. The sequence for ARV7 expression is in accordance with NCBI database (NM_001348061.1) while the targeting sequence for ARV7 knockdown is 5’-GCTCCATAGCTTCCATATTGA-3’ within the 3’-UTR region. For UBE2C depletion, human UBE2C shRNA lentiviral particles (sc-61742-v) were purchased from Santa Cruz Biotechnology, and UBE2C depleted cells were selected using puromycin as well.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!