Cellamp whole transcriptome amplification kit version 2

Total RNA was extracted from WAT and the gastrocnemius muscle using RNeasy Lipid Tissue and RNeasy Plus Universal Mini Kits (QIAGEN, Valencia, CA, USA) according to manufacturer’s instructions. Total RNA was extracted from skeletal muscle myocytes using RNAiso and amplified using CellAmp Whole Transcriptome Amplification Kit Version 2 (Takara Bio Inc., Shiga, Japan).

The surface of the foliate papillae on the tongue of patients was scraped with a small spatula after local anesthesia with 4% lidocaine to collect a sample of the lingual mucosa [11 (link)]. Scraping was performed immediately before and 1 week after the first and second doses of chemotherapy. All tissue scrapings were immediately mixed with RNAlater solution (Ambion, Austin, TX, USA) and the RNA was extracted using an RNAqueous phenol-free RNA isolation kit (Ambion) and amplified using the CellAmp Whole Transcriptome Amplification Kit Version 2 (Takara Bio, Shiga, Japan). Total RNA (1 µg) was reverse-transcribed in a final volume of 20 µL using a Primescript RT Reagent Kit (Takara Bio). The resulting cDNA (50 ng) was subjected to real-time PCR using specific primers in a final volume of 10 µL using a StepOnePlus Real-Time PCR System (Life Technologies, Waltham, MA, USA). The sequences of the primer sets used (forward and reverse, respectively) were 5′–TTCCCCCAGTACGTGAAGAC–3′ and 5′–CAGAGAACGTCTGGTGGTGA–3′ for the human T1R3, and 5′–GAAATCCCATCACCATCTTCCAGG-3′ and 5′–GAGCCCCAGCCTTCTCCATG–3′ for the human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Invitrogen, Waltham, MA, USA). The PCR products were quantified by fit-point analysis and the expression of T1R3 was normalized with that of GAPDH.