Aav9 virus

After completion of behavioral tests, rats in the CUS and control groups were randomly selected for virus injection. Different groups of rats were randomly selected by non-participants. The AAV9-virus was obtained from GENEchem (Shanghai, China). The AAV9-rno-miR-204-5p virus (primer sequence: UUCCCUUUGUCAUCCUAUGCCU) was constructed to overexpress miR-204-5p while the AAV9-rno-miR-204-5p-sponge virus (inverse complementary sequence: AGGCATAGGATGACAAAGGGAA) was used to block miR-204-5p in the DG region of the hippocampus. Rats were anesthetized with an intraperitoneal injection of 2.5% isoflurane as based on their body weights and then positioned within the stereotaxic apparatus (Stoelting, USA). Small burr holes were drilled on two sides of the skull (3.24 mm posterior to bregma and 1.8 mm lateral to the midline) to allow access to the hippocampal DG region for injection of the AAV virus (~ 10¹² infection units per ml, a flow rate of 140 nl/min) at the depth of 3.5 mm. Behavioral tests or biochemical assays were performed at ≥ 14 days after injection. The injection sites were verified after behavioral tests and only rats with correct injection sites were used for analyses in the subsequent assays.

Knockdown mTMC6 gene of WT mice and re-express TMC6 of TMC6-KO mice in the L4 DRG were achieved by affecting the DRG with AAV9 virus, and were produced from Genechem Co., Ltd (Shanghai, China). The mTMC6 DNA sequence referred to NCBI (GenBank: NM_145439). Vectors construction was GV466 (hSyn promoter-MCS-EGFP-3FLAG-SV40 PolyA). AAV9-mTMC6-cDNA (2.29 × 10¹³ v. g./mL), AAV9-control 323 (1.8 × 10¹³ v. g./mL); AAV9-mTMC6-shRNA (2.33 × 10¹³ v. g./mL), target sequence: CCT​GCA​TCA​TTC​TGG​TAT​A, AAV9-control 533 (1.08 × 10¹³ v. g./mL). Diluted virus to 5 × 10¹² v. g./mL before using. Mice were anesthetized with 0.2 mL 1% Pentobarbital dissolved in saline solution. The above-mentioned AAV9 virus were injected into the DRG (right L4). Mice were anaesthetized with 1% pentobarbital sodium and ganglions were exposed surgically. Viral solution was diluted with equal volume PBS and injected into the exposed DRG at a rate of 0.2 mL/min (2 mL per DRG) with a glass micropipette connected to a Hamilton syringe controlled by a microsyringe pump controller (78–8,130, KD Scientific, United States). The glass micropipette was removed after 5 min, then the skin was sutured, the animal was transferred to a recovery cage.