Quantitative PCR was performed as previously described [86 (link)]. Briefly, total RNA was extracted by RNeasy Plus Mini Kit (QIAGEN) and cDNA was obtained by qScript™ cDNA SuperMix (Quanta BioSciences, Inc.). Primers were designed for these loci with the sequences freely available from the Entrez Nucleotide database and the Primer3 algorithm for primer design (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi ). The primers used for qPCR validation are listed in Supplementary Table 4 . PerfeCTa® SYBR® Green FastMix® (Quanta BioSciences, Inc.) was used according to manufacturer’s instructions. PCR reactions were performed on Rotor-Gene RG-3000 Real Time PCR System (Qiagen), with 18S ribosomal RNA used as endogenous control. PCR volume was 20 μl, and conditions were as follow: initial cycle 50°C, 2 min, 95°C, 15 min; 45 cycles at 95°C, 20 s, 60°C, 20 s and 72°C, 20 s; final cycle 72°C, 30 s. Data were analyzed by the Rotor-Gene software using the comparative ΔΔCt method. The relative copy number was calculated based on the target gene/18S RNA ratio.
Rotor gene rg 3000 real time pcr system
Manufactured by Qiagen
Sourced in Germany, Japan, United States
The Rotor-Gene RG-3000 Real Time PCR System is a laboratory instrument designed for real-time polymerase chain reaction (PCR) analysis. It is capable of detecting and quantifying nucleic acid sequences in real-time during the amplification process.
Automatically generated - may contain errors
Lab products found in correlation
Quantitect sybr green pcr kit, by Qiagen (5 mentions)
Primescript rt kit, by Takara Bio (4 mentions)
Sybr premix ex taq 2, by Takara Bio (4 mentions)
Qscript cdna supermix, by Quanta Biosciences (3 mentions)
Perfecta sybr green fastmix, by Quanta Biosciences (3 mentions)
Rneasy plus mini kit, by Qiagen (3 mentions)
Dnase 1, by Thermo Fisher Scientific (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Applied biosystems high capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Sybr premix ex taqtm 2, by Takara Bio (2 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Primescript reverse transcriptase kit, by Takara Bio (1 mentions)
Trizol solution, by Thermo Fisher Scientific (1 mentions)
M mlv transcriptase, by Thermo Fisher Scientific (1 mentions)
Taqman microrna assay, by Thermo Fisher Scientific (1 mentions)
Nanog, by Bioneer (1 mentions)
Pparγ, by Bioneer (1 mentions)
Primescript rt master mix cdna synthesis kit, by Takara Bio (1 mentions)
Rnaiso plus reagent, by Takara Bio (1 mentions)
14 protocols using rotor gene rg 3000 real time pcr system
1
Quantitative PCR for Gene Expression Analysis
2
Quantitative Expression Analysis of Lyz Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the tissue and cell samples was isolated by using TRIzol reagent, digested with DNase I, and reverse transcribed into the first-strand cDNAs with a PrimeScript™ RT Kit (TaKaRa). The expression of the gfLyz-C1 or gfLyz-C2 mRNAs was detected using SYBR Premix Ex Taq™ II (TaKaRa) in the RotorGene RG-3000 Real-Time PCR System (Qiagen, Hilden, Germany). Specific primers for gfLyz-C1 or gfLyz-C2 (Supplementary data 2 ) were designed based on the obtained cDNA sequences, and real-time PCRs were performed by using a SYBR Premix Ex Taq™ II (TaKaRa) under specific conditions (Supplementary data 2 ). EF-1α served as the internal control to verify the real-time PCR data. For the analysis of mRNA expression, the raw data were routinely normalized as the ratio of target gene to EF-1α mRNA detected in the same sample. Given that no significant differences in the expression of the EF-1α mRNA were observed in our experiments, the raw data were simply transformed as a percentage of the mean values in the control group for the statistical analysis. The data are expressed as the means ± SE and were analyzed by using Student’s t-test or one-way ANOVA followed by Fisher’s least significant difference (LSD) test.
3
Quantifying Expression of Liver Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from in vivo liver samples and in vitro hepatocytes samples was isolated by using TRIzol, digested with DNase I (Invitrogen), and reverse transcribed with a PrimeScript™ RT kit (TaKaRa). Transcriptional expression of leptin-AI and leptin-AII, leptin receptor, preproinsulin, IGF-I and IGF-II were detected using SYBR Premix Ex Taq™ II (TaKaRa) in the RotorGene RG-3000 Real-Time PCR System (Qiagen) with primers and PCR conditions as shown in Supplementary table 2 . Serially diluted plasmid DNAs containing the ORF sequences for the target genes were used as the standards for the real-time PCRs. After reactions, the identity of the PCR products was routinely confirmed by analysis of melting curve. In this case, the PCR primers for leptin-AI or leptin-AII amplification were specific, without cross-interaction of the other isoform.
4
Transcriptional Profiling of Hormonal Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the tested samples was isolated using TRIzol reagent, digested with DNase I (Invitrogen, Carlsbad, CA, USA) and reverse transcribed using PrimeScript™ RT kit (TaKaRa, Tokyo, Japan). Transcriptional expression of target genes (PRL, leptin-AI, leptin-AII, lepR, GH, POMC, GTH-α, SL-α, SL-β, and β-actin) was detected using SYBR Premix ExTaq™ II (TaKaRa, Tokyo, Japan), in a Rotor-GeneRG-3000 Real-time PCR System (Qiagen, Hilden, Germany), with primers and PCR conditions as previously reported (Table 1 ) [43 (link),48 (link),65 (link)]. Serially diluted plasmid DNAs containing ORF sequences for the target genes were used as the standards for qPCR. After PCR, the identities of the PCR products were routinely confirmed by melting curve analysis.
5
Quantitative PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative PCR was performed as previously described [71 (link)]. Briefly, total RNA was extracted by RNeasy Plus Mini Kit (QIAGEN) and cDNA was obtained by qScript™ cDNA SuperMix (Quanta BioSciences, Inc.). Primers were designed for these loci with the sequences freely available from the Entrez Nucleotide database and the Primer3 algorithm for primer design (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi ). The primers used for qPCR validation are listed in Supplemental Table 1 . PerfeCTa® SYBR® Green FastMix® (Quanta BioSciences, Inc.) was used according to manufacturer's instructions. PCR reactions were performed on Rotor-Gene RG-3000 Real Time PCR System (Qiagen), with 18S ribosomal RNA used as endogenous control. PCR volume was 20 μl (36-well plate), and conditions were as follow: initial cycle 50°C, 2 min, 95°C, 15 min; 45 cycles at 95°C, 20 s, 60°C, 20 s and 72°C, 20 s; final cycle 72°C, 30 s. Data were analyzed by the Rotor-Gene software using the comparative ΔΔCt method. The relative copy number was calculated based on the target gene/18S RNA ratio.
6
Transcription Profiling of MAPK Pathways in Shrimp
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For measurement of L. vannamei Vg (AY321153), p38 mitogen-activated protein kinases (P38MAPK, JX990130), extracellular regulated protein kinases (ERK, JN035901) and c-Jun N-terminal kinase (JNK, JN035903) gene expressions in the hepatopancreas and in the hepatopancreatic primary cells, total RNA was isolated by using the TRIzol reagent (Invitrogen), digested with DNase I (Invitrogen), and reversely transcribed by using a PrimeScript RT kit (TaKaRa). Transcriptional expression of target genes were detected using SYBR Premix Ex Taq II (TaKaRa) in the RotorGene RG-3000 real-time PCR System (Qiagen) with primers and PCR conditions as shown in S1 Table . Serially diluted plasmid DNAs containing the ORF sequences for the target genes were used as the standards for the real-time PCRs. After reactions, the identities of the PCR products were routinely confirmed by analysis of the melting curve. In this study, real-time PCR of L. vannamei β-actin (JF288784) was used as an internal control because no significant changes were noted for β-actin mRNA in our studies. The raw data of the target gene transcripts were expressed in terms of fmol detected per tube, and the data were routinely normalized as the ratio of β-actin mRNA detected in the same sample.
7
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative PCR was performed as previously described [6 (link)]. Briefly, total RNA was extracted by the RNeasy Plus Mini Kit (QIAGEN) and cDNA was obtained by the qScript™ cDNA SuperMix (Quanta BioSciences, Inc.). Primers were designed for these loci with the sequences freely available from the Entrez Nucleotide database and the Primer3 algorithm for primer design (http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi ). PerfeCTa® SYBR® Green FastMix® (Quanta BioSciences, Inc.) was used according to manufacturer's instructions. PCR reactions were performed on Rotor-Gene RG-3000 Real Time PCR System (Qiagen), with 18S ribosomal RNA used as endogenous control. PCR volume was 20 μl and conditions were as follow: initial cycle 50°C, 2 min, 95°C, 15 min; 45 cycles at 95°C, 20 s, 60°C, 20 s and 72°C, 20 s; final cycle 72°C, 30 s. Data were analyzed by the Rotor-Gene software using the comparative ΔΔCt method. The relative copy number was calculated based on the target gene/18S RNA ratio.
8
Validating Differential Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To verify the expression profiles of genes in our RNA-Seq results, the represented 15 DEGs in comparison of T_2/CT were selected for validation of the Illumina sequences by real-time PCR analysis. All primers used were listed in Table 1 . The treatments of L. vannamei, sampling of muscle, isolation of total RNA and treatment of DNase were performed as described above. The first cDNA strand was synthesized by PrimeScript® Reverse Transcriptase Kit (Takara, China) with an oligo (dT) primer, a qPCR analysis was conducted in a RotorGene RG3000 real-time PCR system (Corbett research, Australia), PCR reactions were conducted using a SYBR Premix Ex TaqTM II (Takara, China), and the reactions were exposed to an initial denaturation (94°C for 3 min) followed by 40 cycles of 94°C for 25 s, 60°C for 15 s, and 72°C for 15 s. The relative transcript abundance was obtained by normalizing with expression of the L. vannamei β-actin gene based on the 2-ΔΔCT method [33 (link)].
9
Quantifying mRNA Expression Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To compare mRNA expression levels, cells were harvested and homogenized in TRIzol solution (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. cDNA was generated using the TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems, Foster Ckty, CA, USA), and real-time PCR was performed using the QuantiTect SYBR Green PCR Kit (Qiagen, Hilden, Germany) and Corbett Research Rotor-Gene RG-3000 Real Time PCR System. The sequence-specific human primers were purchased and rat primers were synthesized (Bioneer, Daejeon, Korea). The rat primers are described in Table 1 .
Primer sequences for the real-time PCR analysis
| Gene | Forward primer | Reverse primer |
|---|---|---|
| Rat iNOS | TCACCTTCGAGGGCAGCCGA | CAGACGCCATGGTGCAGGGG |
| Rat Arg1 | ATTCACCCCGGCTACGGGCA | AGGAGCAGCGTTGGCCTGGT |
| Rat IL-1β | ACCTGTCCTGTGTGATGAAAG | CTCCACTTTGGTCTTGACTTCT |
| Rat TNF-α | GCAGATGGGCTGTACCTTATC | GAAATGGCAAATCGGCTGAC |
| Rat GAPDH | GGCCAAGGTCATCCATGA | TCAGTGTAGCCCAGGATG |
| Rat CD206 | GACGGACGAGGAGTTCATTATAC | GTTGGAGAGATAGGCACAGAAG |
| Rat IL-10 | AGTGGAGCAGGTGAAGAATG | GAGTGTCACGTAGGCTTCTA |
10
Quantification of Angptl4 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To compare the messenger RNA (mRNA) expression level of Angptl4, cells were homogenized in Trizol (Invitrogen, Carlsbad, USA) according to the manufacturer's instructions. cDNA was generated by use of MMLV transcriptase (Invitrogen, Carlsbad, USA). Real time polymerase chain reaction (PCR) was performed using a QuantiTect SYBR Green PCR kit (Qiagen, Valencia, USA) and Corbett Research Rotor-Gene RG-3000 Real Time PCR System. Primers were purchased (Bioneer, Daejeon, Korea).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!