FACS-sorted cells were washed once in PBS and directly diluted in RLT buffer after centrifugation. Total RNA was isolated using the RNeasy Micro and Mini kit (Qiagen) same method used for RNA-seq. First-strand cDNA was synthesized using the SuperScript IITM Reverse Transcriptase (Invitrogen). Quantitative RT-PCR was performed using SYBR Premix Ex TaqTm II (Tli RNase H Plus) (Takara, #RR820A) with technical duplicates using an ABI Prism 7900 HT Cycler (Applied Biosystems). Gene-specific primers spanning intron-exon boundaries were designed using Primer-Blast (NCBI). Primers used in Fluidigm microfluidics technology experiments were designed by Fluidigm. The PCR cycle parameters were as follows: 95°C for 10’ followed by 40 cycles at 95°C for 15” and 60°C for 1’. Results were obtained with the Sequence Detection System 4.2 software (Applied Biosystems) and further analyzed by the 2-ΔΔCt method. β actin was used as a loading control. Results are shown as fold-change relative to wild type controls. Primer specific sequences are listed in S10 Table .
Superscript iitm reverse transcriptase
Manufactured by Thermo Fisher Scientific
Superscript IITM Reverse Transcriptase is a laboratory reagent used to synthesize complementary DNA (cDNA) from a single-stranded RNA template. It is an enzyme that catalyzes the reverse transcription process, converting RNA into DNA for further analysis and applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (3 mentions)
Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (2 mentions)
Abi prism 7900ht cycler, by Thermo Fisher Scientific (1 mentions)
Rneasy mini and micro kit, by Qiagen (1 mentions)
Sybr premix ex taqtm 2 tli rnaseh plus, by Takara Bio (1 mentions)
Topo ta cloning kit, by Thermo Fisher Scientific (1 mentions)
Platinum taq dna polymerase high fidelity, by Thermo Fisher Scientific (1 mentions)
Applied biosystems 3730 dna analyzer, by Thermo Fisher Scientific (1 mentions)
Minelute gel extraction kit, by Qiagen (1 mentions)
Sybr green master mix, by Vazyme (1 mentions)
Rotor gene 6000 thermal cycler, by Qiagen (1 mentions)
Quantifast sybr green pcr kit, by Qiagen (1 mentions)
Sybr green based master mix, by Thermo Fisher Scientific (1 mentions)
Superscript 3 platinum sybr green one step rt qpcr kit, by Thermo Fisher Scientific (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
Stratagene mx3000p qpcr system, by Agilent Technologies (1 mentions)
Confocal laser scanning microscope, by Leica camera (1 mentions)
Sybr green master mix, by Thermo Fisher Scientific (1 mentions)
8 protocols using superscript iitm reverse transcriptase
1
Quantitative Real-Time PCR Protocol
2
Viral cDNA Cloning and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primer design was aided by Clone Manager 9 (Professional Edition (c) 1994-2010, Scientific and Educational Software, Cary, NC, USA). cDNA was generated from total RNA using Invitrogen’s SuperScript IITM reverse transcriptase and the appropriate oligonucleotide primers (denaturation phase 5 min at 94 °C; synthesis phase 1 h at 42 °C). This was followed by PCR performed on the cDNA template using Invitrogen Platinum®Taq DNA Polymerase High Fidelity. Amplified cDNA fragments were gel purified and extracted using a MinElute Gel Extraction Kit (QIAGEN), ligated into the pCR 2.1 TOPO vector, and cloned using the TOPO TA Cloning Kit as described by the supplier (Invitrogen, Carlsbad, CA, USA). Plasmids with virus-derived cDNA inserts were sequenced by Sanger sequencing at the Nucleic Acid Protein Service Unit, UBC, (Vancouver, BC, Canada), on an Applied Biosystems 3730 DNA Analyzer (Thermo-Fisher, Waltham, MA, USA).
3
Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA (~1 µg) was isolated from ground tissues using Trizol reagent (Invitrogen) and treated with RNase-free DNase. First-strand cDNA was synthesized using oligo (dT)-18 primer and Superscript IITM Reverse Transcriptase (Invitrogen). Actin was used as an internal control for both RT-PCR and qRT-PCR. The qRT-PCR analysis was performed in triplicate for each sample using SYBR green master mix (Vazyme Biotech Co., Ltd) in a StepOnePlus™ Real-time PCR System (Applied Biosystems). Relative expression levels of the genes were computed using the 2–ΔΔCT method of relative quantification (Livak and Schmittgen, 2001 (link)). Gene-specific primers are listed in Supplementary Table S1 .
4
ALCAM Expression Quantification in LSCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ALCAM expression was assessed by RT-qPCR. The cDNA of 44 paired LSCC and NSM was synthesized with SuperScriptIITM Reverse Transcriptase (Invitrogen®) and quantitative PCR was carried out with the Quantifast SYBR Green PCR kit (Qiagen) in a Rotor-Gene 6000 thermal cycler (Qiagen). Gene expression quantification was performed as previously described [53 (link)]. Specific oligonucleotides were used in the expression levels analyses, as follows: ALCAM Forward 5′-AAGTGTGCAGTACGACGATGT-3′; ALCAM Reverse 5′-GGTTGCTTGAACACCTTGACT-3′; GAPDH Forward 5′ CAACAGCCTCAAGATCATCAGCAA 3′, GAPDH Reverse 5′ AGTGATGGCATGGACTGTGGTCAT 3′. RT-qPCR analyses were conducted in triplicate, using TE-1 cells as positive control, whereas negative control reactions were performed without cDNA.
5
Quantitative Gene Expression Analysis in Rice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was isolated from the rice samples using the TRIzol reagent (Invitrogen), and it was treated with RNase-free DNase. First-strand cDNA was reverse-transcribed from ~1 µg total RNA using the oligo (dT)18 primer (Superscript IITM Reverse Transcriptase, Invitrogen). OsActin1 (LOC_Os03g50885) was used as an internal control for the qPCR. Each qPCR assay was performed in triplicate using an SYBR green-based master mix (Vazyme) on a StepOnePlus™ real-time PCR system (Applied Biosystems). The relative expression levels of the genes were computed by using the 2−ΔCT method. The gene-specific primers used in this study are listed in Table S1 .
6
Transcriptional Analysis of Salt Stress Response in Rice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the shoot and root tissues of the salt-tolerant and salt-sensitive rice seedlings after subjecting them to NaCl stress for different time intervals (0–24 h) by using RNeasy kit (Qiagen). Trace amount of DNA was removed by RNase-free DNase treatment. The RNA quality was analyzed on 1.2% (w/v) formaldehyde gel and quantified with NanoDrop 1000 Spectrophotometer (Thermo Scientific, United States). The primers for the Real-time PCR were designed from the exonic sequences using IDT SciTools software. First-strand cDNA was synthesized using oligo (dT)-18 primer and reverse transcribed using Superscript IITM Reverse Transcriptase (Invitrogen). Eukaryotic elongation factor1TM-alpha (EF1A) was used as an internal control. The RT-qPCR analysis was performed by using SuperScript III Platinum SYBR Green One-Step RT-qPCR Kit (Invitrogen) in a Stratagene Mx3000P qPCR system (Agilent Technologies, United States). The data were analyzed by Mxpro-QPCR software (Stratagene). Relative expression levels of the genes were computed by the 2-ΔΔCT method of relative quantification (Livak and Schmittgen, 2001 (link)). All the gene-specific primers used are listed in Supplementary Table S1 . The RT-qPCR was done using six biological replicates.
7
Isolation and Characterization of OsPDR2 in Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA (~1 µg) was isolated from the ground tissues using Trizol reagent (Invitrogen) and treated with RNase-free DNase. First-strand cDNA was synthesized using oligo (dT)-18 primer and reverse transcribed using Superscript II TM Reverse Transcriptase (Invitrogen). OsActin (LOC_Os03g50885) was used as an internal control for both RT-PCR and qRT-PCR. The qRT-PCR analysis was performed in triplicate for each sample using SYBR green master mix (Vazyme) in StepOnePlus™ Real-Time PCR System (Applied Biosystems). Relative expression levels of the genes were computed by the 2 -ΔΔC T method of relative quanti cation (Livak and Schmittgen 2001) . All the gene-speci c primers used are listed in Supplementary Table S1.
Transient expression of OsPDR2 in tobacco leaves for subcellular localization Agrobacterium-mediated transformation was employed for the transient co-expression of 35S::EGFP::OsPDR2 and 35S::mCherry::HDEL in the epidermal leaf cells of tobacco as described (Bürstenbinder et al. 2013) . Tobacco leaves were collected 2-3 d after in ltration. A 488 nm (EGFP) and 561 nm (mCherry) diode laser were used for the excitation and EGFP/mCherry uorescence was visualized using a confocal laser scanning microscope (Leica).
Transient expression of OsPDR2 in tobacco leaves for subcellular localization Agrobacterium-mediated transformation was employed for the transient co-expression of 35S::EGFP::OsPDR2 and 35S::mCherry::HDEL in the epidermal leaf cells of tobacco as described (Bürstenbinder et al. 2013) . Tobacco leaves were collected 2-3 d after in ltration. A 488 nm (EGFP) and 561 nm (mCherry) diode laser were used for the excitation and EGFP/mCherry uorescence was visualized using a confocal laser scanning microscope (Leica).
8
Stress Effects on Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression analyses were conducted for CM, C, SM, TS, and TS+SM treatments (n = 3 replicate pools each representing the average gene expression of 60 embryos per treatment i.e. a total of 180 embryos per treatment). Embryos were snap-frozen at -80°C immediately after experimental treatments. Total RNA was extracted using a High Pure RNA isolation kit (Sigma-Aldrich) following the manufacturer's recommendations. cDNA was synthesized using Superscript II TM Reverse Transcriptase (Invitrogen, Life Technologies Ltd.) with sample randomisation. TaqMan® Gene Expression Assays (ThermoFisher Scientific) and 2X qPCR Bio Probe Hi-ROX (PCRBiosystems) were used to quantify the expression of three genes of interest (SQOR, SOD1, and IL-1β) normalised to two reference genes (ef1-ɑ, β-actin). The effects of stress medium and thermal stress on the Log2 2 -ΔΔCT (Log2 fold-change) values were investigated using the eBayes and lmFit functions within the limma package (Ritchie et al., 2015) (link)
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!