M mlv

Manufactured by Thermo Fisher Scientific

Sourced in United States, Germany, China, United Kingdom

M-MLV is a reverse transcriptase enzyme derived from the Moloney Murine Leukemia Virus. It is commonly used for the conversion of RNA into complementary DNA (cDNA) in reverse transcription reactions.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

M-MLV RT kit (58 citations) M-MLV kit (43 citations) M-MLV Reverse Transcriptase enzyme (34 citations) Moloney Murine Leukaemia virus (M-MLV) reverse transcriptase (4 citations) M-MLV assay kit (3 citations) M-MLV First-Strand Transcriptase (2 citations) Virus (M-MLV) reverse transcriptase (2 citations) M-MLV cDNA synthesis system (2 citations) Superscript II RNaseH minus M-MLV reverse transcriptase (2 citations) Invitrogen™ M-MLV reverse transcriptase (2 citations)

292 protocols using m mlv

RNA Isolation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

All leaves were from natural conditions in paddy fields. Leaves were homogenized in liquid nitrogen and stored for a short time. Total RNA was isolated using TRIZOL® reagent (Invitrogen, CA, USA) and purified using Qiagen RNeasy columns (Qiagen, Hilden, Germany).
Reverse transcription was performed using Moloney murine leukemia virus (M-MLV; Invitrogen). A total volume of 10 μL containing 2 μg total purified RNA and 20 pmol random hexamers (Invitrogen) was heated at 70°C for 2 min and then chilled on ice for 2 min. M-MLV and the reaction buffer were added to a total volume of 20 μL containing 200 units of M-MLV, 20 pmol random hexamers, 500 μM dNTPs, 50 mM Tris-HCl (pH 8.3), 3 mM MgCl₂, 75 mM KCl, and 5 mM dithiothreitol, and samples were then heated at 37°C for 1.5 h.
cDNA samples were diluted to 2 ng/μL for qRT-PCR assays performed on 1 μL of each cDNA dilution using SYBR Green Master Mix (Applied Biosystems, PN 4309155). The relative quantification method (ΔΔCT) was used to evaluate quantitative variation between replicates examined (Livak and Schmittgen, 2001 (link)). Primers for specific genes are listed in Table S7.

Zhao N., Sheng M., Zhao J., Ma X., Wei Q., Song Q., Zhang K., Xu W., Sun C., Liu F, & Su Z. (2020). Over-Expression of HDA710 Delays Leaf Senescence in Rice (Oryza sativa L.). Frontiers in Bioengineering and Biotechnology, 8, 471.

+ Open protocol

+ Expand

Comparative Evaluation of Reverse Transcriptases

Check if the same lab product or an alternative is used in the 5 most similar protocols

Three reverse transcriptases were tested in this study. These include: (1) Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV) (28025013, ThermoFisher Scientific), a recombinant DNA polymerase that lacks DNA endonuclease activity and has a lower RNase H activity. M-MLV has an optimal activity at 37 °C. (2) SuperScript III Reverse Transcriptase (SSIII) (18080093, ThermoFisher Scientific), generated by introducing several mutations into M-MLV to further reduce RNase H activity and increase half-life. SSIII has an optimal activity at 50 °C. Compared to M-MLV, SuperScript III Reverse Transcriptase was found to produce higher cDNA yields, improved cDNA lengths and enhanced efficiency on GC-rich target RNAs. (3) SuperScript IV Reverse Transcriptase (SSIV) (18090010, ThermoFisher Scientific), an enzyme developed particularly for challenging samples such as poorly purified RNA that contains inhibitors, RNA from formalin-fixed, paraffin-embedded (FFPE) samples, and unpurified RNA. The enzyme demonstrates low variability especially at low amount of input RNA and has the highest thermostability (100% activity up to 56 °C and 90% activity at 60 °C) among the 3 reverse transcriptases.

Long S, & Berkemeier B. (2021). Development of a reverse transcription droplet digital PCR (RT-ddPCR) assay for sensitive detection of simian immunodeficiency virus (SIV). Virology Journal, 18, 35.

+ Open protocol

+ Expand

RNA Isolation and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

First, tissue samples were transferred from RNA later solution (Invitrogen, #AM7021) to RLT buffer (part of the RNEasy Mini Kit, Qiagen, Hilden, Germany, #74106) supplied with β‐mercaptoethanol and homogenized with 5‐mm steel beads (Qiagen; #69989) using TissueLyser II (#85300; Qiagen). Total RNA was isolated using RNEasy Mini Kit according to the manufacturer's instructions. The concentration and purity of isolated RNA were determined spectrophotometrically using a Nanodrop ND‐1000 spectrophotometer. The integrity of each RNA sample was analyzed using the Agilent RNA 6000 Nano kit run on an Agilent 2100 Bioanalyzer. Only samples without significant degradation were used for subsequent steps.
RNA was then reverse‐transcribed using M‐MLV (#28025013; Invitrogen) according to the manufacturer's instructions. Each 20 μL reaction contained up to 2 μg total RNA, 2.5 μm oligo(dT)₂₀ primers (#18418020; Invitrogen), 50 ng random hexamers (100 ng if more than 1 μg RNA was transcribed), 40 units of RNAseOUT, 200 units of M‐MLV reverse transcriptase, and other components as specified by the manufacturer.

Knedlík T., Vorlová B., Navrátil V., Tykvart J., Sedlák F., Vaculín Š., Franěk M., Šácha P, & Konvalinka J. (2017). Mouse glutamate carboxypeptidase II (GCPII) has a similar enzyme activity and inhibition profile but a different tissue distribution to human GCPII. FEBS Open Bio, 7(9), 1362-1378.

+ Open protocol

+ Expand

Quantification of Gene Expression by RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using Trizol Reagent according to the manufacturer’s instructions. One microgram of RNA was reverse transcribed into cDNA using reverse transcriptase (MMLV, Thermofisher) and oligodT (Eurogentec, Seraing, Belgium). RT-qPCR was performed on StepOnePlus Real-Time system (Thermofisher) using Power SYBR Green PCR (Thermofisher). Sequences of the primers used are listed in Supplemental Table S1. β-actin gene (Actb) was used as an endogenous reference gene. Relative gene expression was analyzed using the StepOnePlus software and calculated using the 2^−∆∆Ct method, or the standard curve method, depending on the efficiency of Actb amplification and each target gene, and expressed as the mean of triplicate samples [68 (link)].

Rakic R., Bourdon B., Hervieu M., Branly T., Legendre F., Saulnier N., Audigié F., Maddens S., Demoor M, & Galera P. (2017). RNA Interference and BMP-2 Stimulation Allows Equine Chondrocytes Redifferentiation in 3D-Hypoxia Cell Culture Model: Application for Matrix-Induced Autologous Chondrocyte Implantation. International Journal of Molecular Sciences, 18(9), 1842.

+ Open protocol

+ Expand

RNA Extraction and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Vector and eIF4E-FLAG cells were harvested at 70% confluent and total cell lysate RNA was extracted using TRIzol (ThermoFisher Scientific cat # 15596026). Samples were processed using Dynabeads Oligo (dT)₂₅ (ThermoFisher Scientific cat # 61005) and final RNA extracted via TRIzol (ThermoFisher Scientific cat # 15596026). cDNA synthesis was done using MMLV (ThermoFisher Scientific cat. # 28025013). PCR at 55°C annealing and 30 cycles was performed for quality control using ACTIN and VEGF, and final analysis was done using RT-qPCR.

Davis M.R., Delaleau M, & Borden K.L. (2019). Nuclear eIF4E Stimulates 3′-End Cleavage of Target RNAs. Cell reports, 27(5), 1397-1408.e4.

+ Open protocol

+ Expand

Quantifying RNA Cleavage and Polyadenylation

Check if the same lab product or an alternative is used in the 5 most similar protocols

eIF4E-FLAG+ LacZ or LacZ-4ESE cells were plated in a 15 cm tissue culture dish (GIBCO) to 70% confluent (36–48 hours) and were trypsinized with 0.5% trypsin-EDTA (ThermoFisher Scientific cat # 15400–054). Cells were washed twice in ice cold PBS and fractionated as detailed above. RNA was extracted using TRIzol (ThermoFisher Scientific cat # 15596026), and cDNA was synthesized using MMLV (ThermoFisher Scientific cat. # 28025013) (RNA (300ng-1μg) and DNase treated (Ambion, cat # AM2238). NA (300ng-1μg). RT-qPCR was performed (as described above) on nuclear lysates and whole cell lysates using described primers for LacZ and LacZ-4ESE to bracket the cleavage site to measure uncleaved and cleaved pre-mRNAs, LacZ uncleaved Fwd 5′CCCGTGCCTTCCTTGAC3′, LacZ uncleaved Rvs 5′ATGACACCTACTCAGACAATG3′, LacZ cleavage Rvs 5′TTTTTTTTTTTTGCGATGCAA3′. Cleavage was calculated as the nuclear uncleaved or cleaved expression of LacZ (or LacZ-4ESE) / total cell lysate LacZ (or LacZ-4ESE) expression, respectively. LacZ transcript (LacZ and LacZ-4ESE) cleavage and PAS site location was verified using Quant Seq 3′ mRNA-Seq Library Prep Kit REV for Illumina (LEXOGEN cat # SKU: 016.96.), as per manufacturer’s instructions. Sequencing was performed via Miseq, 1 Flowcell v3 (25M de fragments), 150 cycles, Paired-End (maximum 2 × 85 nt) in three biological replicates.

Davis M.R., Delaleau M, & Borden K.L. (2019). Nuclear eIF4E Stimulates 3′-End Cleavage of Target RNAs. Cell reports, 27(5), 1397-1408.e4.

+ Open protocol

+ Expand

RNA Extraction and cDNA Synthesis for qPCR and RNA-Seq

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was prepared using RNA-Mini-Kit (Seqlab, Göttingen, Germany). For RT-qPCR, cDNA was synthesized using 0.8–1 μg of RNA, random hexamer oligonucleotides and MMLV (Thermo Scientific) according to the manufacturer's instruction. Then cDNA was subjected to PCR amplification using different primers (Supplementary Information, Text S1) and Absolute qPCR SYBR Green Mix (Thermo Scientific). For RNA-seq, libraries were prepared using TruSeq stranded mRNA Kit (Illumina) according to manufacturer's instructions.

Feld C., Sahu P., Frech M., Finkernagel F., Nist A., Stiewe T., Bauer U.M, & Neubauer A. (2018). Combined cistrome and transcriptome analysis of SKI in AML cells identifies SKI as a co-repressor for RUNX1. Nucleic Acids Research, 46(7), 3412-3428.

+ Open protocol

+ Expand

Mosquito Tissue RNA Extraction and qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fat bodies or heads (10 tissues per tube) from female mosquitoes were dissected in PBS and stored at −80°C in 300µl TRI Reagent (ThermoFisher Scientific). Samples were thawed and bead beaten using 2mm beads. Then RNA was extracted using manufacturer’s instructions with a modification to wash the RNA pellet using 70% ethanol. 2.5µg of RNA was aliquoted and DNase treated with Turbo DNase from the TURBO DNA-free Kit (ThermoFisher Scientific), followed by DNase inactivation from the same kit. cDNA synthesis was carried out in 100µl reactions using random primers (ThermoFisher Scientific), dNTPs (ThermoFisher Scientific), first strand buffer (VWR), RNAseOUT (ThermoFisher Scientific) and MMLV (ThermoFisher Scientific). Relative quantification RT-qPCR was carried out using SYBR-Green mix and primers from Supplemental Table 4. Primers were designed on exon-exon junctions where possible. Quantification was performed in triplicate using the QuantStudio 6 Pro qPCR machine (ThermoFisher Scientific). Rpl19 was used as the endogenous control for relative quantification.

Stryapunina I., Itoe M., Trinh Q., Vidoudez C., Du E., Mendoza L., Hulai O., Kauffman J., Carew J., Shaw W.R, & Catteruccia F. (2023). Interplay between nutrient transporters ensures fertility in the malaria mosquito Anopheles gambiae. bioRxiv.

+ Open protocol

+ Expand

RNA Isolation and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated with TRIzol^TM (Thermo Fisher Scientific), according to the manufacturer’s protocol, and concentrations were determined with the NanoDrop 2000 (Thermo Fisher Scientific). Reverse transcription PCR was performed in a 25 μL reaction volume with 1 μg of RNA, 4 μL of 5× first strand buffer, 1 μL of 12.5 mM dNTPs, 2.04 μL of 2.5 μg/μL random primers, 2 μL of 0.1 M DDT, 1 μL of M-MLV (all Thermo Fisher Scientific), and 0.5 μL of RNAsin (Promega Corporation) using the Applied Biosystems Thermal Cycler 2720. The PCR program included 10 min at 20 °C, 45 min at 42 °C, and 10 min at 95 °C. Quantitative PCR was performed with 4 μL of cDNA (10 ng/mL), 10 μL of SYBR Green master mix (Applied Biosystems, Thermo Fisher Scientific, Breda, the Netherlands), and 6 μL of primer mix (containing 1 μM forward primer and 1 μM reverse primer) using the Bio-Rad CFX96. The program consisted of 7 min at 95 °C, followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C, and 10 min at 95 °C. Fold change values were calculated relative to the housekeeping gene using the ΔΔCt formula. The primers used are summarized in Supplementary Table S4.

Diepeveen L.E., Stegemann G., Wiegerinck E.T., Roelofs R., Naber M., Lóreal O., Smeets B., Thévenod F., Swinkels D.W, & van Swelm R.P. (2022). Investigating the Molecular Mechanisms of Renal Hepcidin Induction and Protection upon Hemoglobin-Induced Acute Kidney Injury. International Journal of Molecular Sciences, 23(3), 1352.

+ Open protocol

+ Expand

Quantifying RNA Cleavage and Polyadenylation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Davis M.R., Delaleau M, & Borden K.L. (2019). Nuclear eIF4E Stimulates 3′-End Cleavage of Target RNAs. Cell reports, 27(5), 1397-1408.e4.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!