Qiamp viral rna kit

For RNA extraction of midges, midges were homogenized in 500 µl of PBS using microbeads- containing tubes and a Ribolysor apparatus (Bio-rad, Marne-la Coquette, France). After clarification by centrifugation (2 minutes, 1000 g), RNA was extracted using the Qiamp viral RNA kit (Qiagen).
Viral RNA was extracted from 100 µl whole blood using the Qiamp viral RNA kit. Cellular RNA was extracted from EDTA blood using Trizol-LS extraction. The extracted cellular RNA was checked for quality with an Agilent 2100 Bioanalyzer using RNA 6000 Nano Kits (Agilent Technologies).

The collected blood sera (100 µL) were directly mixed with 400 µL of AVL buffer from the QIAmp Viral RNA kit (Qiagen, Courtaboeuf, France). The whole brain and liver of euthanized mice were weighed and homogenized in a 500 µL DMEM using Tissue Lyser II (Qiagen). The viral RNAs were purified using the QIAmp Viral RNA kit (Qiagen) following the manufacturer’s protocol. The detection of the RVFV M segment was conducted by RT-qPCR using the SuperScript III Platinum One-Step qRT-PCR kit (Thermo Fisher Scientific, Villebon-sur-Yvette, France), as described elsewhere [35 (link),36 (link)]. The efficiencies were estimated from the standard curves based on ten-fold dilutions of each viral stock, and were used to convert the Ct values to PFU-per-milliliter equivalents (eqPFU/mL) for the sera, or PFU-per-gram equivalents (eqPFU/g) for the tissues. Wilcoxon–Mann–Whitney test analyses were conducted using R software.

RT-PCR was utilized to detect the presence or absence of viral RNA per mL of blood or per mg of tissue. These assays were developed as a diagnostic assay for alphavirus infection. As such, the RT-PCR assay was not intended to be quantitative in nature. Experimental conditions were modified for the semi-quantitative analysis of RNA copies in samples by comparing blood and tissue samples to a linear synthetic RNA standard. Viral RNA was extracted from blood and tissues using commercially available kits (QIAmp Viral RNA kits, Qiagen, Hilden, Germany) according to the manufacturer’s specifications. Positive and negative extraction controls (PEC and NEC, respectively) were created by supplementing uninfected control NHP blood with a known amount of virus (1.0 × 10⁴ PFU for the PEC) or RNase-free water (for the NEC). The primers used for IC studies were forward, CTGTTTAAGCTTGGCAAACC; reverse, AATTCCCACTCGATTCCAGC; probe, 6FAMTGACAGGAGAAGGGCATTACACGAAGAGMGBNFQ. Primers for the IAB studies were forward, CTGTTTAAGCTTGGCAAACC; reverse, ATACCCACTCGGTTCCAGCG; and probe, 6FAMTGACAGGAGAAGGGCATTGCATGAAGAGMGBNFQ. The assay limit of detection ranged from 1.0 × 10⁷ viral genome copies/µL (upper limit of detection [ULOD]) to 1.0 × 10¹ viral genome copies/µL (lower limit of detection [LLOD]).