RNA extraction for all samples was performed using 200 μL of the purified RBC with RNAiso Blood (Cat#9112, Takara Bio, Kusatsu, Shiga, Japan), according to the manufacturer’s instructions. The extracted total RNA solution in Milli-Q water (30 μL) was diluted and adjusted to a concentration of 100 ng/uL. The RNAs were pooled within each time point, and the degree of degradation was confirmed using an Agilent RNA 6000 Nano Kit (Cat# 5067-1511; Agilent Technologies, Santa Clara, CA, USA) on a Bioanalyzer (Agilent Technologies). Next, 500 ng of RNA was used to make cDNAs with the PrimeScript RT Master Mix (Cat#RR036A, Takara Bio), according to the manufacturer’s instructions. The cDNAs, as templates, were diluted at ×10 using Milli-Q water and subjected to qPCR assay based on SYBR Green dye. The extracted total RNA was also subjected to total RNA sequencing (RNA-Seq).
Rnaiso blood
Manufactured by Takara Bio
Sourced in Japan, China
RNAiso Blood is a reagent used for the isolation and purification of total RNA from whole blood samples. It is designed to efficiently extract high-quality RNA from small blood volumes.
Automatically generated - may contain errors
Lab products found in correlation
Rnaiso plus, by Takara Bio (4 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Exoquick tc, by System Biosciences (3 mentions)
Bioanalyzer, by Agilent Technologies (2 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Agilent rna 6000 nano kit, by Agilent Technologies (1 mentions)
High capacity cdna reverse transcription kit, by Takara Bio (1 mentions)
Power tb green, by Takara Bio (1 mentions)
Qtower3g, by Analytik Jena (1 mentions)
Protoscript 2 reverse transcriptase, by New England Biolabs (1 mentions)
Primescripttm rt reagent kit, by Takara Bio (1 mentions)
Miscript sybr green pcr kit, by Roche (1 mentions)
Rt master mix kit, by Takara Bio (1 mentions)
Sybr green 1 qpcr kit, by Takara Bio (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
T100 thermal cycler, by Bio-Rad (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
23 protocols using rnaiso blood
1
RNA Extraction and Transcriptomic Analysis
2
Exosomal lncRNA H19 Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from serum-derived exosomes using RNAiso Blood (Takara, China) according to the manufacturer’s instruction. The extracted RNA was dissolved in 10 μL of RNase-free water. The quality and quantity of RNA were evaluated by a NanoDrop Spectrophotometer (Thermo Fisher Scientific, USA). The total RNAs were reverse-transcribed using a high-capacity cDNA reverse transcription kit (TAKARA) to confirm the expression of lncRNA H19 and internal control. qPCR was performed using Power TB Green (Takara) on the qtower3 G (Analytik Jena, Germany), which was also used for data collection. β-actin was used as an internal control. The primers for lncRNA H19 were (forward) 5′-ACTCAGGAATCGGCTCTGGAAGG-3′ and (reverse) 5′-GATGTGGTGGCTGGTGGTCAAC-3′; primers for β-actin were (forward) 5′-ATCAAGATCATTGCTCCTCCTGA-3′ and (reverse) 5′-CTGCTTGCTGATCCACATCTG-3′. The reaction conditions for RT-qPCR were 95°C for 30 s, followed by 40 cycles of 95°C for 5 s, 60°C (the optimal annealing temperature) for 31 s, and 72°C for 10 s. The relative expression levels of lncRNA H19 were analyzed by the 2−ΔΔCt method.
3
RNA Extraction and RT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from approximately 1 × 106 cells using RNAiso Blood (TaKaRa) and 0.5 μg was reverse transcribed using ProtoScript II Reverse Transcriptase (New England BioLabs). An SPO11-specific amplicon of ~700 bp was produced using the following primers: RT-SPO11 forward – TGTTTAAATATTATTGCTTCAGC, reverse – ATAAACTCAGCATTTTCAATCC. The loading control was an HSP70-specific PCR product of ~500 bp, produced using the following primers: RT-HSP70 forward – ATCTCTTGGGTAAGTTCAACC, reverse – TTGAAGACTTCTTCCAAAG.
4
Profiling Circulating CircRNA Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Venous blood (2.5 ml) was withdrawn from each participant into a PAXgene Blood RNA tube. Total RNA was extracted from samples using the RNAiso Blood (TAKARA), followed by RNase R digestion. Reverse transcription was performed by using the PrimeScriptTMRT reagent Kit (TAKARA) according to the manufacturer’s instructions with minor modification. Briefly, the reaction mixture, with gDNA eraser added, was incubated for 2 min at 42°C, followed by incubation with reverse transcriptase for 15 min at 37°C. The reaction mixtures were then incubated for 5 s at 85°C to inactivate miScript Reverse Transcriptase. Quantitative PCR was carried out using the miScript SYBR® Green PCR Kit (Roche, United States). The primer sequences used for the detection of human circRNAs were designed based on circRNA conservation analysis using the Primer Assay Program (Biosen, China). GAPDH was used as a control. Primer sequences for human circRNAs are shown as Supplementary Table S1 .
5
Extraction and Quantification of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PAs and PVs were de-endothelialized, frozen in liquid nitrogen, and mechanically homogenized. Total RNA was isolated from the tissues and cells using RNAiso Blood (Takara Bio, Inc., Otsu, Japan), according to the manufacturer's protocols. RT-qPCR experiments followed standard protocols. RNA (1 µg) was first reverse transcribed to cDNA with random primers using the RT Master Mix kit (Takara Biotechnology, Dalian, China). RT-PCR was performed by using the PrimeScript RT reagent kit (Takara Biotechnology) and the T100 Thermal Cycler (Bio-Rad Laboratories, Inc., Hercules, CA, USA) according to the manufacturer's instructions. The RT-PCR cycling conditions were as follows: 37°C for 15 min, 85°C for 5 sec and 4°C for holding. Real-time PCR experiments followed standard protocols using the SYBR Green I qPCR kit (Takara Biotechnology). The PCR cycling conditions were as follows: 95°C for 30 sec, followed by 40 cycles at 95°C for 5 sec and 60°C for 31 sec. The relative mRNA quantities of target genes were normalized to the values of β-actin. The results were expressed as fold changes of threshold cycle value relative to the controls using the 2−ΔΔCq method (36 (link)).
6
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from mouse whole blood and kidney samples using RNAiso Blood (TaKaRa Bio) and ISOGEN II (Nippon Gene Co., Ltd., Toyama, Japan) kits, respectively, and from mouse CD4+ (in spleen) and human CD3+ T cells (in PBMCs) using an RNeasy mini kit (Qiagen, Venlo, Netherlands). The methods of quantification of mRNA expression levels and qRT-PCR analysis of CD3+ T cell-derived samples were the same as our previous report [8 (link)]. The expression levels of mouse Actb and human TFRC were used as internal controls for the CD4+ and CD3+ T cell samples, respectively. All primers are shown in Additional file 2 : Table S3.
7
Isolation and Quantification of exRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
exRNA samples were isolated from 5 to 10 mL TCM, lung TCM, liver TCM, and human lung EC-CMs using RNAiso Blood (Takara) with Ethachinmate (Nippon Gene). Total RNA samples were isolated from cells using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and used to generate cDNA with reverse transcriptase (SuperScript VILO, Invitrogen). For the reverse transcription with GSP, SuperScript III reverse transcriptase (Invitrogen) was used. cDNA from exRNA was amplified using TaqMan PreAmp Master Mix (Applied Biosystems, Foster City, CA, USA) before qPCR analysis. qPCR was performed using SYBR Green Master Mix or TaqMan Fast Advanced Master Mix (Applied Biosystems) in a detection system (StepOnePlus; Applied Biosystems). The gene expression levels were calculated from Ct values, and the relationship between the Ct value and the logarithm of the copy number of the target gene was confirmed to be linear using serial dilutions of the corresponding isolated DNA as a standard. In addition, gene expression levels of nuclear and cytoplasmic samples were normalized to that of Hotair and βactin, respectively. The primer sequences and probes are listed in Supplementary Table S5 .
8
Serum RNA Extraction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Serum samples were assayed in a blinded manner. Total RNA was extracted from 0.25-mL serum samples using RNAiso Blood (Takara, Japan) according to the manufacturer’s instruction. Briefly, RNAiso Blood reagent (threefold more than the sample volume) was added to each serum sample, which was then lysed thoroughly via violent vortexes. Next, chloroform and isopropyl alcohol were used to precipitate RNA. The obtained RNA precipitate was then washed with 75% ethanol. Finally, RNA was quantified using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).
9
Plasma RNA Extraction and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Peripheral blood plasma or bone marrow plasma was filtrated with a sterile syringe filter with a 0.45-μm pore size membrane to remove cells. Total RNA was extracted from plasma with RNAiso Blood (Takara Bio, Shiga, Japan) according to manufacturer's instructions. The extracted RNA was quantitated with the fluorescent dye RiboGreen and a Qubit 3.0 Fluorometer (Life Technologies, Carlsbad, USA) according to manufacturer's protocol.
Blood samples from 40 healthy persons were obtained in Niitsu Medical Center Hospital, and blood and bone marrow samples from four myeloma patients were in Niigata Cancer Center Hospital. Written informed consent was obtained from each person, and this study was approved by the ethics committee of Niigata University of Pharmacy and Applied Life Sciences (Permit Numbers: H28–008 and H29-007) according to Ethical Guidelines for Medical and Health Research Involving Human Subjects (Public Notice of the Ministry of Education, Culture, Sports, Science and Technology and the Ministry of Health, Labour and Welfare, Japan, No. 3 of 2014).
Blood samples from 40 healthy persons were obtained in Niitsu Medical Center Hospital, and blood and bone marrow samples from four myeloma patients were in Niigata Cancer Center Hospital. Written informed consent was obtained from each person, and this study was approved by the ethics committee of Niigata University of Pharmacy and Applied Life Sciences (Permit Numbers: H28–008 and H29-007) according to Ethical Guidelines for Medical and Health Research Involving Human Subjects (Public Notice of the Ministry of Education, Culture, Sports, Science and Technology and the Ministry of Health, Labour and Welfare, Japan, No. 3 of 2014).
10
Exosome Isolation and RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TCMs and lung CM that serum-free cocultured with or without TCMs (lung TCM/CM) were centrifuged 300 × g for 5 min, and the supernatants were further centrifuged 3000 × g for 10 min and filtered. Exosomes can be fractionated by size-exclusion chromatography, ultracentrifugation, magnetic bead pull-down assay, and polymer precipitation66 (link). Among them, ExoQuick-TC (System Biosciences), a polymer used to precipitate exosomes, is the best method to eliminate exosomes from CM.
The samples were treated by ExoQuick-TC (System Biosciences) overnight and then centrifuged 1500 × g for 30 min. The supernatants were further centrifuged 20,000 × g. The resulting supernatants were treated by RNAiso Blood (Takara Bio) to obtain RNA as extraexosome RNA. The exosome pellets were washed by PBS and treated by Trizol reagent (Thermo Fisher Scientific) to isolate exosome RNA. All procedures were carried out at 4 °C.
The samples were treated by ExoQuick-TC (System Biosciences) overnight and then centrifuged 1500 × g for 30 min. The supernatants were further centrifuged 20,000 × g. The resulting supernatants were treated by RNAiso Blood (Takara Bio) to obtain RNA as extraexosome RNA. The exosome pellets were washed by PBS and treated by Trizol reagent (Thermo Fisher Scientific) to isolate exosome RNA. All procedures were carried out at 4 °C.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!