qPCR was performed using SYBRGreenR and a Bio-Rad iQ iCycler Detection System. Primers were as follows: human SK-1: forward: 5′-GCT TCC TTG AAC CAT TAT G-3′; reverse: 5′-TCT CTA GGT CCA CAT CAG-3′; human CTGF: forward: 5′-TGC CTG CCA TTA CAA CTG TCC-3′, reverse: 5′-GCC ATG TCT CCG TAC ATC TTC C-3′; human fibronectin: forward: 5′-CGA AAT CAC AGC CAG TAG-3′; reverse: 5′-ATC ACA TCC ACA CGG TAG-3′; human Spns2: forward: 5′-ACT TTG GGG TCA AGG ACC GA-3′; reverse: 5′-AAT CAC CTT CCT GTT GAA GCG-3′; human MCP-1: forward: 5′-CCC CAG TCA CCT GCT GTT AT-3′; reverse: 5′-TGG AAT CCT GAA CCC ACT TC-3′; human aquaporin 1: forward: 5′-TGG ACA CCT CCT GGC TAT TG-3′; reverse: 5′-GGG CCA GGA TGA AGT CGT AG-3′; 18S RNA: forward: 5′-CGA TTC CGT GGG TGG TGG TG-3′; reverse: 5′-CAT GCC AGA GTC TCG TTC GTT ATC-3′. 1 μg of total RNA isolated with TRIzolR (Thermo Fisher Scientific) reagent was used for reverse transcriptase cDNA synthesis (First Strand Synthesis Kit, Thermo Fisher Scientific); a random hexamer primer was used for amplification. Real-time fluorescence from SYBRR Green (Sigma Aldrich) was measured by the Bio-Rad CFX Manager 3.1 System Software. The fold induction values were obtained, according to the ΔΔCt method, after normalization to the housekeeping gene 18S RNA.
Icycler iq detection system
Manufactured by Bio-Rad
Sourced in United States, Italy, Germany, Denmark
The iCycler iQ detection system is a real-time PCR instrument designed for quantitative gene expression analysis. It features a thermal cycler that can accommodate up to 96 samples and a sensitive fluorescence detection system for monitoring amplification in real-time.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (20 mentions)
Rneasy mini kit, by Qiagen (16 mentions)
Iq sybr green supermix, by Bio-Rad (13 mentions)
Iscript cdna synthesis kit, by Bio-Rad (13 mentions)
Sybr green, by Bio-Rad (8 mentions)
Quantitect primer assay, by Qiagen (6 mentions)
Iscript select cdna synthesis kit, by Bio-Rad (6 mentions)
Sensiscript reverse transcriptase, by Qiagen (5 mentions)
Quantifast sybr green pcr master mix, by Qiagen (5 mentions)
Omniscript rt kit, by Qiagen (4 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (4 mentions)
Rna extraction kit, by Qiagen (4 mentions)
Sybr green 1, by Thermo Fisher Scientific (4 mentions)
Sybr green universal pcr master mix, by Bio-Rad (4 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (4 mentions)
Retroscript kit, by Thermo Fisher Scientific (3 mentions)
Iq5 optical system software, by Bio-Rad (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Rnase free dnase, by Qiagen (3 mentions)
Revertaid h minus first strand cdna synthesis kit, by Thermo Fisher Scientific (3 mentions)
106 protocols using icycler iq detection system
1
Quantitative PCR Analysis of Gene Expression
2
Quantifying NLRP3 Expression in CVB3-Induced Myocarditis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA from heart tissues of the CVB3-induced myocarditis model rats was extracted utilizing Trizol reagent (Takara, Japan) followed by reverse-transcribing into cDNAs via a Prime Script™ RT Master Mix kit (Takara, Japan). Subsequently, a Bio-Rad iQ iCycler detection system was applied to amplify the cDNA through the SYBR Green detection method. The expression of the specific NLRP3 transcripts was normalized to the expression of β-actin and measured using the 2−ΔΔCt method. β-Actin, forward primer 5′-TCACCGAGCGCGGCT-3′, and reverse primer 5′-TAATGTCACGCACGATTTCCC-3′; NLRP3, forward primer 5′-ACGGCAAGTTCGAAAAAGGC-3′, and reverse primer 5′-AGACCTCGGCAGAAGCTAGA-3′.
3
Quantitative Real-Time PCR Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was performed using a BioRad iQ iCycler Detection System (BioRad Laboratories; Hercules, CA) with iQ SYBR Green Supermix. Reactions were performed in a total volume of 20 μl - including 10 μl 2× SYBR Green PCR Master Mix, 300 nM of each primer, and 1 μl of the previously reverse-transcribed cDNA template.
4
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells by using TRIZOL reagent (Invitrogen, Grand Island, NY), or Nucleospin RNA (Macherey-Nagel, Deer Park, NY) according to the protocols of the manufacturers. cNDA synthesis was performed with 1 µg of total RNA using Omniscript RT kit according to manufacturer’s protocol (Quiagen, Valencia, CA), and was diluted 1:5 in autoclaved nanopure water for further analysis. Real-time PCR was performed using Bio-Rad iQ iCycler detection system with iQ SYBR green supermix (Bio-Rad Laboratories Ltd, Hercules, CA). Reactions were performed in a total volume of 10 µl, including 5 µl of 2X iQ SYBR green supermix, 1 µl of primers at 20 pmol/µl and 1 µl of cDNA template. All reactions were carried out in at least triplicates for every sample. Data were normalized to 18 S rRNA, or GAPDH.
5
Quantitative Analysis of Neuroglobin Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the TRIzol reagent (Life Technologies, U.S.A.). Five hundred nanograms of total RNA was reverse transcribed using the RETROScript cDNA synthesis kit (Life Technologies, U.S.A.).
Real-time PCR was performed using 7900HT Fast Real Time PCR by Applied Biosystems, the iTaqTM Universal SYBRR Green Supermix (Biorad) a Bio-Rad iQ iCycler detection system with SYBR green fluorophore. A melting curve analysis was made after each run to ensure a single amplified product for every reaction. All reactions were run at least in triplicate for each sample. Primers to study NGB expression were as follows NGB-Forward: 5′-TGGAAGACCTGTCCTCACTG-3′ and NGB-Reverse: 5′-GAGCAGAGACTCACCCACTG-3′ (Zhang et al., 2011 (link)). Gene expression was normalized using specific amplification of 18S.
Real-time PCR was performed using 7900HT Fast Real Time PCR by Applied Biosystems, the iTaqTM Universal SYBRR Green Supermix (Biorad) a Bio-Rad iQ iCycler detection system with SYBR green fluorophore. A melting curve analysis was made after each run to ensure a single amplified product for every reaction. All reactions were run at least in triplicate for each sample. Primers to study NGB expression were as follows NGB-Forward: 5′-TGGAAGACCTGTCCTCACTG-3′ and NGB-Reverse: 5′-GAGCAGAGACTCACCCACTG-3′ (Zhang et al., 2011 (link)). Gene expression was normalized using specific amplification of 18S.
6
RNA Extraction and Real-Time PCR Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells or tissue samples by using TRIZOL reagent
according to the protocol of the manufacturer (Invitrogen, Grand Island, NY).
cDNA synthesis was performed with 1 µg of total RNA using Omniscript RT kit
according to manufacturer’s protocol (Qiagen, Valencia, CA). cDNA was diluted
1:5 in DEPC-treated nanopure water and used for further analysis. Real-time PCR
was performed using Bio-Rad iQ iCycler detection system with iQ SYBR green
supermix (Bio-Rad Laboratories Ltd, Hercules, CA). Reactions were performed in a
total volume of 10 µL, including 5 µL of 2X iQ SYBR green supermix, 0.4 µL of
primers at 20 pmol/µL and 0.4 µL of cDNA template. All reactions were carried
out at 4 repeats for every sample and 3 independent experiments for each group.
GAPDH was used as a housekeeping gene for normalization. Primers used in
Real-time PCR were according to previous studies.27 (link)
according to the protocol of the manufacturer (Invitrogen, Grand Island, NY).
cDNA synthesis was performed with 1 µg of total RNA using Omniscript RT kit
according to manufacturer’s protocol (Qiagen, Valencia, CA). cDNA was diluted
1:5 in DEPC-treated nanopure water and used for further analysis. Real-time PCR
was performed using Bio-Rad iQ iCycler detection system with iQ SYBR green
supermix (Bio-Rad Laboratories Ltd, Hercules, CA). Reactions were performed in a
total volume of 10 µL, including 5 µL of 2X iQ SYBR green supermix, 0.4 µL of
primers at 20 pmol/µL and 0.4 µL of cDNA template. All reactions were carried
out at 4 repeats for every sample and 3 independent experiments for each group.
GAPDH was used as a housekeeping gene for normalization. Primers used in
Real-time PCR were according to previous studies.27 (link)
7
Quantitative RT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two micrograms of total RNA were treated with DNase (Invitrogen) and 1 μg was used for complementary DNA (cDNA) synthesis. The reaction was carried out using random decamers and the First strand cDNA synthesis kit (Invitrogen) following the manufacturer’s recommendations.
PCR primers used were as follows: forward 5′-AAGCCATACCAAACGACGAG-3′, reverse 5′-TTGCCGGGAAGCTAGAGTAA-3′. β2-Microglobulin was used as a reference for normalization Forward 5′-CGGCAGGCATACTCATCTTT-3′, Reverse: 5′-GGTTTCATCCATCCGACATT-3′, and relative quantification was analyzed using iCycler iQ Optical System Software Version 3.0a (BioRad). Real-time PCR was performed using a Bio-Rad iQ iCycler Detection System (Bio-Rad) with SYBR green fluorophore (Bio-Rad). Reactions were performed in a total volume of 20 μL-including 10 μL 2× SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA), 5 μL of each primer at 5 μM concentration, and 1 μL of the previously reverse-transcribed cDNA template. Protocols for each primer set were optimized using five serial 10× dilutions of template cDNA obtained from SW-480. PCR reactions consisted of 30 cycles with optimal conditions as follows: 94 °C for 20 s; 50 °C for 1 min; 72 °C for 30 s; and an optimized collection data step, 80 °C for 5 s. All samples were run in triplicate.
PCR primers used were as follows: forward 5′-AAGCCATACCAAACGACGAG-3′, reverse 5′-TTGCCGGGAAGCTAGAGTAA-3′. β2-Microglobulin was used as a reference for normalization Forward 5′-CGGCAGGCATACTCATCTTT-3′, Reverse: 5′-GGTTTCATCCATCCGACATT-3′, and relative quantification was analyzed using iCycler iQ Optical System Software Version 3.0a (BioRad). Real-time PCR was performed using a Bio-Rad iQ iCycler Detection System (Bio-Rad) with SYBR green fluorophore (Bio-Rad). Reactions were performed in a total volume of 20 μL-including 10 μL 2× SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA), 5 μL of each primer at 5 μM concentration, and 1 μL of the previously reverse-transcribed cDNA template. Protocols for each primer set were optimized using five serial 10× dilutions of template cDNA obtained from SW-480. PCR reactions consisted of 30 cycles with optimal conditions as follows: 94 °C for 20 s; 50 °C for 1 min; 72 °C for 30 s; and an optimized collection data step, 80 °C for 5 s. All samples were run in triplicate.
8
BACE1 Expression Profiling in Rodents
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Animals (n = 6) in each group were anesthetized and transcardially perfused with saline after the behavioral assessment. Brains were rapidly removed and cut sagittally. Total RNA from hemi-brains was extracted utilizing Trizol RNAiso plus and reverse-transcribed into cDNA using a PrimeScript RT Master Mix kit. PCR amplification reactions were performed using a Bio-Rad iQ iCycler detection system with the SYBR green detection method. The expression of the specific BACE1 transcripts was normalized against the expression of β-actin. The specific primer (Invitrogen, USA) sequences used in this study were as follows23 (link): BACE1: F, GCTGCAGTCAAGTCCATCAA; R, ATTGCTGAGGAAGGATGGTG; and β-actin: F, CCACACCCCGCCAGTTC; R, GACCCATACCCACCATCACACC.
9
Quantitative Analysis of HOTAIR, miR-488-5p, NUP205, and Bcl-2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) in accordance with the manufacturer’s protocol. The concentrations of different total RNA were determined BCA kit followed by transcription into cDNA (Takara Biotechnology Co., Ltd., Dalian, China) by the PrimeScript RT Master Mix kit (Invitrogen, Carlsbad, CA, USA). Then the PCR amplification reactions were performed using the SYBR green detection method under the help of Bio-Rad iQ iCycler detection system. The specific primer sequences used here were as follows: HOTAIR, F: 5’-GGGTGGCTCACTCTTCTGGC-3’, R: 5’- TGGCCTTGCCCGGGCTTGTC-3’; miR-488-5p, F: ACACTCCAGCTGGGTAGCAGCACATCATGG, R: TGGTGTCGTGGAGTCG; NUP205, F: GAAACTTCTGGACATTGAAGGA, R: TGAGGATGGAACTAGGGGAAG; Bcl-2, F: 5’-GCTCAGCCCTGTGCCACCTG-3’; R: 5’-CAGAGGTCGCATGCTGGGGC-3’; Glyceraldehyde 3-phosphate dehydrogenase (GAPDH), F: 5’-CGCTCTCTGCTCCTCCTGTTC-3’, R: 5’-ATCCGTTGACTCCGACCTTCAC-3’. Each sample was subjected to a 3-hole replicates and the experiment was repeated twice. The densitometry of relative mRNA expression was performed using the calculation of 2-ΔΔCq and GAPDH was used as an internal control.
10
Measuring mRNA Decay Kinetics
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!