Morpholino oligonucleotide

Zebrafish were maintained under standard conditions at 28°C in the core facility at Albert Einstein College of Medicine as described previously [24 (link), 25 (link)]. Embryos were collected from mated pairs and Morpholino oligonucleotides and/or mRNAs were injected before the 4 cell stage. Following injection, embryos were maintained at 28°C in egg water [26 ]. Morpholino oligonucleotides were obtained from Genetools, LLC, and dissolved in distilled water according to manufacturer’s instructions. Sequences of Morpholino oligonucleotides are as follows: Ctrl-MO (Genetools standard control): CCTCTTACCTCAGTTACAATTTATA; CPA6-MO2: AGAAAATAAGGGACTCACTGTCAAG; CPA6-MO4: CTTGTCAGCCATGTGCTCACCTCTT. CPA6 mRNA was generated from a zebrafish CPA6 plasmid using the mMESSAGE mMACHINE kit (Ambion) according to manufacturer’s instructions. In experiments where mRNA and morpholino oligonucleotide were co-injected into embryos, reagents were mixed beforehand and injected as a single bolus. This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Institute for Animal Care and Use Committee of the Albert Einstein College of Medicine (Protocol Number: 20140102).

Morpholino oligonucleotides (Gene Tools) were suspended in distilled water, and stored at room temperature at a concentration of 1 mM. Zebrafish embryos were microinjected with a pressure injector with approximately 3 nano-liter volumes at the 1-cell stage. For cxcr2 knockdown, a cxcr2 MO targeting the ATG region (5′- ACTCTGTAGTAGCAGTTTCCATGTT-3′) [18] (link), was used at 100 µM.
For irf8 knockdown, a previously published splice blocking irf8 MO [59] (link) (5′-AATGTTTCGCTTACTTTGAAAATGG-3′) [18] (link), was used at 100 µM. For knockdown of exogenous Krt4 driven genes, a krt4 MO targeting the region directly upstream of the ATG of targets cloned downstream of Krt4 using the BamHI cloning site (krt4 MO: 5′-GCTGCTGAGAGACACGCAGAGGGAT-3′) was used at 20 µM (knockdown through 15 hpf). As a control, Gene Tools standard control morpholino (5′- CCTCTTACCTCAGTTACAATTTATA-3′) was used at 100 µM. Gene knockdown was obtained by injecting 3 nano-liter of solution into the cytoplasm of one-cell stage embryo.

Rabbit anti-RIP3 antibody, Nec-1, and propidium iodide (PI) were obtained from Sigma-Aldrich (St Louis, MO, USA), rabbit anti-β-tubulin was from Abcam (Cambridge, UK), and the fluorescein isothiocyanate-Annexin V/PI apoptosis assay kit was from Clontech (Mountain View, CA, USA). Morpholino oligonucleotides were synthesized by Gene Tools, LLC (Philomath, OR, USA). Bicinchoninic acid assay was purchased from Pierce (Rockford, IL, USA). Lipid peroxidation (MDA) was obtained from Jian-Cheng Biotechnical Co. (Nanjing, Jiangsu, China). Goat anti-rabbit secondary antibody was obtained from Jackson Immuno Research Inc. (Lancaster, PA, USA).