Aceq sybr master mix

RNA was isolated from harvested cells or human tissues with Trizol reagent according to the manufacturer's instruction (Invitrogen, CA, USA). To measure expression levels of miR-137, stem-loop specific primer method was used as follows: forward primer: GCTCCTCAGGTCGAACCTATTG; Reverse primer: CCGACGCTATTGCTTAAGAATACG. Expression of U6 was used as an endogenous control. To determine the mRNA levels of VEGF, total RNAs were reversely transcribed by oligodT primer using PrimeScript RT Reagent Kit (Vazyme, Nanjing, China). Housekeeping gene GAPDH was used as internal control, primers were used as described before [40 (link)]. The cDNAs were amplified by qRT-PCR using AceQ SYBR Master Mix (Vazyme, Nanjing, China) on a 7900HT system, and fold changes were calculated by relative quantification (2^−ΔΔCt).

Total RNAs of cells were extracted using TRIzol reagent (Invitrogen, CA, USA) according to the manufacturer’s instruction. To test miR-143 expression, expression of U6 was used as an endogenous control. To determine expression of miR-143 forward primer: GCTCGTCGAGATAAGCTGTGTG; reverse primer: GTTCGCTGAGATGAAGCACTG. To determine the mRNA levels of VEGF, total RNAs were reversely transcribed by oligodT primer using PrimeScript RT Reagent Kit (Vazyme, Nanjing, China). Housekeeping gene GAPDH was used as internal control. The cDNAs were amplified by qPCR using AceQ SYBR Master Mix (Vazyme, Nanjing, China) on a 7900HT system. Relative fold changes in expression of the target gene transcripts were determined using the comparative cycle threshold method (2^-ΔΔCt).

Total RNA was extracted from tissue samples and cell lines using TRIzol reagent according to the manufacturer’s instructions (Invitrogen). First-strand cDNA was synthesized using HiScriptQ RT SuperMix for qPCR (Vazyme, Nanjing, China). Quantitative real-time PCR was performed using AceQ SYBR Master Mix (Vazyme, Nanjing, China) on a 7900HT system. The PCR primers used to amplify target genes were as follows: RNF43, forward 5′-CAAATTCACAGCCAGTGTGG-3′ and reverse 5′-GTCCTTTCCTTTCCCAGGAG-3′; β-actin, forward 5′-GCTCGTCGTCGACAACGGCTC-3′ and reverse 5′-CAAACATGATCTGGGTCATCTTCTC-3′; and Sox-2, forward 5′-GGATGGTTGTCTATTAACTT-3′ and reverse 5′-TCAAACTTCTCTCCCTTT-3′. β-actin was used as the reference gene. The Ct values of the samples were calculated, and the relative levels of mRNA were analyzed by the 2^–ΔΔCT method. Each sample was analyzed in triplicate to minimize the stochastic error.