Protoscript 2 rt

Example 5

Example 5 demonstrated the enhanced efficiency of V3 in RT-PCR. V3 RT, ProtoScript II and MMuLV RT in RT-PCR. qRT-PCR was performed using primer pairs ACTB (ACTB-F:CTGGAACGGTGAAGGTGACA (SEQ ID NO:13); ACTB-RR, AAGGGACTTCCTGTAACAACGCA (SEQ ID NO:14)) targeting the Actin B gene or B2M (B2M-F: TGCTGTCTCCATGTTTGATGTATCT (SEQ ID NO:15); B2M-R: TCTCTGCTCCCCACCTCTAAGT (SEQ ID NO:16) targeting the B2M gene with 10 ng of Jurkat cell total RNA. The qRT-PCR performed in 25 μl of 1× ThermoPol® buffer (New England Biolabs, Ipswich, Mass.) supplement with MgSO4 to a final of 3 mM Mg++, 400 uM each dNTP, 0.625 U Hot Start Taq DNA polymerase (New England Biolabs, Ipswich, Mass.), 400 nM each of the forward and reverse primer, 2 μM SYTO 9. For RT, it is either 50 ng of V3 RT, or 100 U ProtoScript II RT (New England Biolabs, Ipswich, Mass.) or 100 U MMuLV RT (New England Biolabs, Ipswich, Mass.). The reaction mix was incubated at 54° C. for 5 minutes and then temperature cycled at 95° C. for 10 seconds, 58° C. for 15 seconds, and 68° C. for 30 seconds. The DNA amplification signal was acquired on a Bio-Rad CFX96 thermal cycler. As shown in FIG. 5A-B, V3 RT generated a robust qRT-PCR signal much more rapidly than did the other enzymes.