Generally, DNA assembly was done by USER-fusion (29 (link),30 (link)) employing uracil-specific excision reagent (USER™) enzyme from New England Biolabs. PCR fragments were generated using Phusion U Hot Start DNA Polymerase (Thermo Fisher). Details for construction of individual plasmids are provided in Supplementary Methods S1 . All plasmids and primers used in this study are presented in Supplementary Table S2 and Supplementary Table S3 , respectively. All plasmid maps are available for download as GenBank files.
Phusion u hot start dna polymerase
Manufactured by Thermo Fisher Scientific
Sourced in United States
Phusion U Hot Start DNA Polymerase is a high-fidelity DNA polymerase designed for accurate and efficient DNA amplification. It provides robust performance and reliable results for a wide range of PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
User enzyme, by New England Biolabs (4 mentions)
Epijet bisulfite conversion kit, by Thermo Fisher Scientific (3 mentions)
Dneasy blood tissue kit, by Qiagen (3 mentions)
Pfuturbo cx hotstart dna polymerase, by Agilent Technologies (3 mentions)
Milli q water purification system, by Merck Group (3 mentions)
Proteinase k, by New England Biolabs (2 mentions)
Genomic dna clean concentrator kit, by Zymo Research (2 mentions)
Milli q purification system, by Merck Group (2 mentions)
Illustra templiphi 100 amplification kit, by GE Healthcare (2 mentions)
Gblock gene fragment, by Integrated DNA Technologies (2 mentions)
Mach1, by Thermo Fisher Scientific (2 mentions)
Hyclone water, by GE Healthcare (2 mentions)
2100 bioanalyzer, by Agilent Technologies (2 mentions)
Kld enzyme mix, by New England Biolabs (2 mentions)
Neb turbo cells, by New England Biolabs (2 mentions)
Kod hot start dna polymerase, by Merck Group (2 mentions)
Gblocks gene fragment, by Integrated DNA Technologies (2 mentions)
45 60 mer oligonucleotides, by Integrated DNA Technologies (2 mentions)
Neb turbo, by New England Biolabs (2 mentions)
Dh5α cells, by New England Biolabs (2 mentions)
27 protocols using phusion u hot start dna polymerase
1
DNA Assembly using USER Fusion
2
Ultrasensitive 5mC Detection in Genomic DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For 5mC detection, 200 ng of mouse E14 genomic DNA was mixed with 10 ng unmethylated lambda DNA, 10 ng of XP12 phage DNA, and 1 ng of CpG methylated pUC19 DNA and then incubated with 16 μg of TET2 enzyme (NEB EM-seq component E7130A) for 30 min at 37°C in 50 μL 1× reaction buffer (EM-seq TET2 Reaction Buffer [reconstituted], E7128A, and E7131A diluted) followed by a 30-min incubation with 20 U of T4 BGT (NEB EM-seq component E7129A) in the same buffer at 37°C. Oxidized genomic DNA was incubated additional 30 min with 0.8 U of Proteinase K (NEB) at 37°C and subsequently purified with a Genomic DNA Clean & Concentrator kit (Zymo Research). Purified DNA was then denatured at 90°C in presence of 29% of formamide for 10 min and deaminated with 100 U of APOBEC3A (NEB EM-seq components E7133AA and E7134AA) in 100 μL reaction volume for 3 h. Three microliters of deaminated genomic DNA and control DNAs was used without further purification for PCR amplifications with Phusion U hot start DNA Polymerase (Thermo Fisher Scientific) using primer pairs listed in Supplemental Table S9 . For some amplicons (Supplemental Table S9 , eight to 11 primer pairs), we used the enzymatic EM-seq conversion module (NEB E7125) for 5mC detection.
3
Analyzing DNA Methylation Dynamics
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from 80% confluent control, PKM2KD, P53KD, PKM2KD/P53KD, RELBKD and PKM2KD/RELBKD HUVECs 48 h after transfection, using the DNeasy Blood & Tissue kit (Qiagen, 69504). Bisulfite conversion was performed using the EpiJET Bisulfite Conversion Kit (Thermo Scientific, #K1461) according to the manufacturer’s instructions. PCR amplification of bisulfite-converted DNA was performed using Phusion U Hot Start DNA Polymerase (Thermo Scientific, F555S) with the following primers: MLT1B_Fwd—AGTTATAGATAGGTATAGAGTGTTGGTTTATAG; MLT1B_Rev—CCTATTCTAACCATTTTCTATCAATAAAATC; MER4D_Fwd—TTTGAGGAAGTGTGTTTGAGGTTGTTAGGATG; MER4D_Rev—CCTCTAACACTACCTTAACTCAAACATTTC. Following PCR amplification, samples were purified and then digested with HpyCH4III (MER4D) or HincII (MLT1B) for 8 h, and visualized on a 3% agarose gel.
4
DNA Cloning and Verification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids and selection phage
were constructed
using USER cloning or KLD Enzyme Mix (NEB, Ipswich, MA). DNA fragments
were generated by PCR using Pfu Turbo Cx Hotstart DNA Polymerase (Agilent),
VeraSeq 2.0 High Fidelity DNA Polymerase (Enzymatics), or Phusion
U Hot Start DNA Polymerase (Thermo Fisher Scientific). All amplicons
were purified using kits from Qiagen and digested with DpnI during
PCR fragment assembly for USER cloning. All restriction endonucleases
and USER enzyme were purchased from NEB. Assembled vectors were transformed
into chemically competent E. coli of various
strains and verified by Sanger sequencing after amplification from
individual colonies using Illustra TempliPhi DNA Amplification kits
(GE Healthcare). Cell growth for cloning purposes was carried out
using 2xYT media supplemented with appropriate antibiotics (Kanamycin,
50 μg/mL; Carbenicillin, 50 μg/mL; Spectinomycin, 100
μg/mL). For phage cloning and replication, phage were transformed
directly into S1059, S1381 or an equivalent phage containing a PSP-gene
III plasmid (e.g., pJC175e or similar)9 (link) and grown overnight. All transformed phage cultures
were then plated on lawns of this same strain and individual plaques
were picked into fresh media, grown for a minimum of 6 h, and verified
by Sanger sequencing after amplification using Illustra TempliPhi
DNA Amplification kits (GE Healthcare).
were constructed
using USER cloning or KLD Enzyme Mix (NEB, Ipswich, MA). DNA fragments
were generated by PCR using Pfu Turbo Cx Hotstart DNA Polymerase (Agilent),
VeraSeq 2.0 High Fidelity DNA Polymerase (Enzymatics), or Phusion
U Hot Start DNA Polymerase (Thermo Fisher Scientific). All amplicons
were purified using kits from Qiagen and digested with DpnI during
PCR fragment assembly for USER cloning. All restriction endonucleases
and USER enzyme were purchased from NEB. Assembled vectors were transformed
into chemically competent E. coli of various
strains and verified by Sanger sequencing after amplification from
individual colonies using Illustra TempliPhi DNA Amplification kits
(GE Healthcare). Cell growth for cloning purposes was carried out
using 2xYT media supplemented with appropriate antibiotics (Kanamycin,
50 μg/mL; Carbenicillin, 50 μg/mL; Spectinomycin, 100
μg/mL). For phage cloning and replication, phage were transformed
directly into S1059, S1381 or an equivalent phage containing a PSP-gene
III plasmid (e.g., pJC175e or similar)9 (link) and grown overnight. All transformed phage cultures
were then plated on lawns of this same strain and individual plaques
were picked into fresh media, grown for a minimum of 6 h, and verified
by Sanger sequencing after amplification using Illustra TempliPhi
DNA Amplification kits (GE Healthcare).
5
Versatile DNA Cloning using USER Technology
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primers used in this study are listed in Table 2 . PCR of DNA fragments for USER cloning was performed with primers containing uracil using the Phusion U Hot Start DNA Polymerase (Thermo Fisher Scientific). Colony PCR was performed with Taq 2x Master Mix (New England Biolabs) in order to detect positive colonies. Reactions were done according to manufacturers’ recommendations with elongation times and annealing temperatures adjusted for specific targets and primers. In most cases annealing temperature was 60°C and elongation time was programmed at 30 seconds per 1 kb. DNA cloning was performed using USER (uracil-specific excision reagent) technology. It is a simple and robust method, allowing seamless DNA insertions [33 (link)]. PCR-amplified DNA fragments containing a primer-incorporated uracil close to both of their 5’-ends were mixed (purification after PCR was not necessary) and treated with DpnI enzyme (Thermo Fisher Scientific) for 30 min at 37°C to digest template DNA. USER™ enzyme (New England Biolabs) was then added, and the mixture was incubated in three steps: 1) 37°C for 15 min; 2) 12°C for 15 min; 3) 10°C for 10 min. It was then transferred on ice and mixed with chemically competent E. coli cells.
6
Bisulfite Sequencing of Promoter Regions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The promoter regions of the kitl (NM_013598) and amh (NM_007445) genes, 1 kb upstream of the transcription start sites, were extracted using the UCSC Table Browser tool (http://genome.ucsc.edu/ ) (24). Primers used for bisulfite sequencing PCR were designed with the aid of Methprimer (25) (Table I). A 50-μl PCR mixture contained 10 mM dNTP, 1.8 μl of each 10 pmol primers, 1 U of Phusion U Hot Start DNA polymerase (Thermo Scientific, #F-555S), 10 μl of GC buffer, 1 μl of DMSO, and 4 μl of bisulfite-treated DNA.
PCR program with the following thermal settings was applied: hot start at 98°C for 30 sec, 30 cycles of denaturation at 98°C for 10 sec, annealing temperature for 30 sec (Table I), extension at 72°C for 30 sec, and a final extension at 72°C for 5 min. The PCR products were sent directly to Bioneer (South Korea) for purification and Sanger sequencing. The sequencing was performed one time with forward primers, and the results were analyzed using BioEdit V 7.2.6.1.
PCR program with the following thermal settings was applied: hot start at 98°C for 30 sec, 30 cycles of denaturation at 98°C for 10 sec, annealing temperature for 30 sec (Table I), extension at 72°C for 30 sec, and a final extension at 72°C for 5 min. The PCR products were sent directly to Bioneer (South Korea) for purification and Sanger sequencing. The sequencing was performed one time with forward primers, and the results were analyzed using BioEdit V 7.2.6.1.
7
Methylation Analysis of Genomic DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total genomic DNA was isolated from DAOY and HCT116 cells using the Isolate II Genomic DNA Kit (BIO-52067, Meridian BIOSCIENCE, Memphis, Tennessee United States). Four hundred nanograms of total DNA was treated with bisulfite to convert unmethylated cytosine to uracil using the Protocol A of EpiJET Bisulfite Conversion Kit (K1461, Thermo Fisher Scientific).
Either methylated or unmethylated DNA was used for PCR amplification carried out using Phusion U Hot Start DNA Polymerase (Thermo Fisher Scientific, F-555S/L). PCR primers were designed by the EpiDesigner software1 and are listed in Supplementary Table 1 .
The amplificated DNAs were then sequenced using the Sanger method [as previously reported (Belardinilli et al., 2015 (link); Nicolussi et al., 2019 )]. Sequencing was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit and a 3130XL Genetic Analyzer (Applied Biosystems–Thermo Fisher Scientific). Sequences were analyzed with the 4Peaks software (Nucleobytes, Aalsmeer, The Netherlands). The methylation level was measured as a ratio of methylated CpG to total CpG.
Either methylated or unmethylated DNA was used for PCR amplification carried out using Phusion U Hot Start DNA Polymerase (Thermo Fisher Scientific, F-555S/L). PCR primers were designed by the EpiDesigner software
The amplificated DNAs were then sequenced using the Sanger method [as previously reported (Belardinilli et al., 2015 (link); Nicolussi et al., 2019 )]. Sequencing was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit and a 3130XL Genetic Analyzer (Applied Biosystems–Thermo Fisher Scientific). Sequences were analyzed with the 4Peaks software (Nucleobytes, Aalsmeer, The Netherlands). The methylation level was measured as a ratio of methylated CpG to total CpG.
8
Whole-Genome Bisulfite Sequencing of B-Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human genomic DNA from lymphoblastoid B- cell lines was obtained from the Coriell Institute for Medical Research. Genomic DNA from the pre-B acute lymphoblastoid leukemia cell line REH (was isolated using the AllPrep Universal kit (Qiagen).
The EZ DNA Methylation Gold kit (Zymo Research) was used for sodium bisulfite conversion of DNA prior to library preparation. All WGBS libraries were prepared from 100 ng of genomic DNA. Accel-NGS Methyl-Seq (Swift BioSciences) and TruSeq DNA Methylation (Illumina Inc) were prepared according to the manufacturer’s protocols. SPLAT libraries were prepared as described previously [13 (link)] with the exception for libraries SPLAT-8 and SPLAT-9 which were amplified with the Phusion U Hot Start DNA polymerase (Thermo Fisher Scientific), whereas the other SPLAT libraries were amplified using the KAPA HiFi Uracil+ DNA polymerase (KAPA Biosystems).
The EZ DNA Methylation Gold kit (Zymo Research) was used for sodium bisulfite conversion of DNA prior to library preparation. All WGBS libraries were prepared from 100 ng of genomic DNA. Accel-NGS Methyl-Seq (Swift BioSciences) and TruSeq DNA Methylation (Illumina Inc) were prepared according to the manufacturer’s protocols. SPLAT libraries were prepared as described previously [13 (link)] with the exception for libraries SPLAT-8 and SPLAT-9 which were amplified with the Phusion U Hot Start DNA polymerase (Thermo Fisher Scientific), whereas the other SPLAT libraries were amplified using the KAPA HiFi Uracil+ DNA polymerase (KAPA Biosystems).
9
Plasmid Cloning by USER Assembly
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids were cloned using either Mach1, Turbo, DH5a, or 10beta cells. Unless otherwise noted, plasmids and phage were cloned by USER assembly (Geu-Flores et al., 2007 (link)) using the Phusion U Hot Start DNA polymerase (Thermofisher, F556L) and USER enzyme (New England Biolabs, M5505L).
10
Antibiotics usage and DNA manipulation protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antibiotics (Gold Biotechnology) were used at the following working concentrations: carbenicillin 50 μg/mL, spectinomycin 50 μg/mL, chloramphenicol 25 μg/mL, kanamycin 50 μg/mL, tetracycline 10 μg/mL, streptomycin 50 μg/mL. HyClone water (GE Healthcare Life Sciences) was used for PCR reactions and cloning. For all other experiments, water was purified using a MilliQ purification system (Millipore). Phusion U Hot Start DNA polymerase (Thermo Fisher Scientific) was used for all PCRs. Plasmids and SPs were cloned by USER assembly21 (link). Genes were obtained as synthesized gBlock gene fragments from Integrated DNA Technologies or PCR amplified directly from E. coli genomic DNA. Plasmids were cloned and amplified using either Mach1 (Thermo Fisher Scientific) or Turbo (New England BioLabs) cells. Unless otherwise noted, plasmid or SP DNA was amplified using the Illustra Templiphi 100 Amplification Kit (GE Healthcare Life Sciences) prior to Sanger sequencing. A full list of plasmids used in this work is given in Supplementary Table 5 Supplementary Table 6
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!