Short hairpin shrna lentiviral particles

MLO‐Y4 osteocytes were silenced using short hairpin shRNA lentiviral particles (Sigma‐Aldrich), following the manufacturer's instructions. After searching the SOST gene sequence in GenBank, three interference sequences of SOST‐shRNA were designed, using the RNA interference from Invitrogen, and artificially synthesized by Sangon Biotech (China). Cells were injected with lentiviral particles carrying either scrambled or SOST‐ specific shRNA. The efficiency of shRNA was evaluated by measuring SOST mRNA and protein expression using real‐time PCR and Western blotting separately. Finally, the most effective sequence of SOST‐shRNA was selected and the shRNA sequence is 5′‐ GACAGCATATCTTACATTAAA ‐3′. MLO‐Y4 cells silenced for SOST were then used as SOST‐shRNA group in the following vitro experiments.

SOST of MLO‐Y4 osteocytic cells was silenced using short hairpin shRNA lentiviral particles (Sigma‐Aldrich Chemical Co), following the manufacturer's instructions. Briefly, after searching the sequence of the SOST gene in GenBank, the interference sequence SOST‐shRNA was designed using RNA interference from Invitrogen. The shRNA sequences were artificially synthesized by Sangon Biotech as follows: 5′–GACAGCATATCTTACATTAAA−3′. Cells were infected with lentiviral particles carrying either scrambled or SOST‐ specific shRNA. The efficiency of deletion was determined by measuring SOST mRNA expression and protein by real‐time PCR and by Western blotting, separately. SOST overexpression of MLO‐Y4 cells were manipulated with the same as SOST silencing.