β actin gtx109639

Manufactured by GeneTex

Sourced in United States

β-actin (GTX109639) is a monoclonal antibody that specifically binds to the β-actin protein. β-actin is a ubiquitous cytoskeletal protein that is involved in various cellular processes such as cell motility, structure, and integrity. This antibody can be used for the detection and quantification of β-actin in a variety of applications.

Automatically generated - may contain errors

Lab products found in correlation

Protein g coupled dynabeads, by Thermo Fisher Scientific (2 mentions) Thiolutin, by Abcam (2 mentions) 5 foa, by Cayman Chemical (2 mentions) Secondary antibodies against rabbit 7074s and mouse 7076s igg, by Cell Signaling Technology (2 mentions) Iaid tag m214 3, by MBL Life Science (2 mentions) Ampure xp bead, by Beckman Coulter (2 mentions) C myc gtx103436, by GeneTex (1 mentions) Cycloheximide (chx), by Merck Group (1 mentions) Penicillin streptomycin, by Corning (1 mentions) Mda mb 231, by American Type Culture Collection (1 mentions) Fetal bovine serum (fbs), by Corning (1 mentions) Bt549, by American Type Culture Collection (1 mentions) Glutagro, by Corning (1 mentions) Olaparib, by MedChemExpress (1 mentions) Salubrinal, by Merck Group (1 mentions) Indoxyl sulfate, by Merck Group (1 mentions) Atrogin 1 ab168372, by Abcam (1 mentions) Lipofectamine r 2000 reagent, by Thermo Fisher Scientific (1 mentions) Bip 610978, by BD (1 mentions) Drop out mix for yeast synthetic medium, by US Biological (1 mentions)

4 protocols using β actin gtx109639

Breast Cancer Cell Line Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human breast cancer cell lines MDA-MB-231 and BT549 were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). Both cell lines were cultured in Dulbecco’s modified Eagle medium (DMEM), and the medium was supplemented with 7% fetal bovine serum (FBS; Corning, New York, NY, USA), 1% glutagro (Corning), and penicillin-streptomycin (Corning). Cells were cultured at 37 °C in a humidified atmosphere of 5% CO₂. Olaparib was purchased from MedChemExpress, the PRMT1 inhibitor C7280948 was purchased from Sigma (St. Louis, MO, USA), and cycloheximide (CHX) was obtained from Sigma. pCMV3-C-FLAG-PRMT1 plasmid (HG11210-CF) was purchased from Sino Biological (Wu-Han, China), and pcDNA-cMyc-HA plasmid was kindly provided by Prof. Cheng Chia-Hsiung (Taipei Medical University). Antibodies against PRMT1 (GTX630187), c-Myc (GTX103436), and β-actin (GTX109639) were purchased from GeneTex (San Antonio, TX, USA).

Hsu W.J., Chen C.H., Chang Y.C., Cheng C.H., TsaI Y.H, & Lin C.W. (2021). PRMT1 Confers Resistance to Olaparib via Modulating MYC Signaling in Triple-Negative Breast Cancer. Journal of Personalized Medicine, 11(10), 1009.

+ Open protocol

+ Expand

Genotypes and Reagents for Yeast Study

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genotypes of strains and yeast plasmids used in this work are listed in Table S3 and S4. All chemicals used in this study were purchased analytical grade from either Sigma-Aldrich or Carl Roth except for the following: Drop Out Mix for yeast synthetic medium (SD) was from US Biological Life Sciences (D9543-01); 5-FOA was bought from Cayman Chemical (17318); Ampure XP beads were from Beckman Coulter (A63881); Protein-G coupled dynabeads from Thermo Fisher Scientific (10009D) and Thiolutin from Abcam (ab143556). Secondary antibodies against rabbit (7074S) and mouse (7076S) IgG coupled to horseradish peroxidase (HRP) were purchased from Cell Signaling. Antibodies against H3K56ac were from Active Motif (39281), G6PDH (A9521) and Myc (MABE282) from Sigma, iAID-tag (M214-3) from MBL International and β-actin (GTX109639) from GeneTex. Antibody dilutions were as suggested by the manufacturer (Table S12).

Kochan D.Z., Mawer J.S., Massen J., Tishinov K., Parekh S., Graef M., Spang A, & Tessarz P. (2021). The RNA-binding protein Puf5 contributes to buffering of mRNA upon chromatin-mediated changes in nascent transcription. Journal of Cell Science, 134(15), jcs259051.

+ Open protocol

+ Expand

Indoxyl Sulfate-Induced Muscle Atrophy

Check if the same lab product or an alternative is used in the 5 most similar protocols

Indoxyl sulfate (IS), N‐Acetyl‐l‐cysteine (NAC), 2′,7′‐dichlorofluorescin diacetate (DCF‐DA), and salubrinal were purchased from Sigma‐Aldrich. The following antibodies were used: Phospho‐eIF2α (Ser51) (9721S) and Phospho AKT (Ser473) (9271S) from Cell Signalling Technology (Danvers, MA); eIF2α (D‐3) and MYH (H‐300) from Santa Cruz Biotechnology (Dallas, TX); BiP (610978) from BD Biosciences; myoG (GTX63352), GAPDH (GTX100118), and β‐actin (GTX109639) from Genetex (Hsinchu City, Taiwan). Atrogin 1 (ab168372) from Abcam (Cambridge, MA); myoD (5.8A) (NB100‐56511) from Novus Biologicals (Littleton CO), and Myc (CSB‐MA000041M0m) from Cusabio (China). AKT1 (C20) was kindly provided by Dr. Jim‐Tong Horng of Chang Gung University, Taiwan. Anti‐mouse IgG (H + L) and anti‐rabbit IgG (H + L) antibodies were purchased from Genetex. siRNA against XBP1 (siXBP1:CCUUGUAGUUGAGAACCAGGAGUUA) and scrambled siRNA (siCtrl: medium GC of Stealth negative control duplex) were purchased from ThermoFisher Scientific and transfected into cells with Lipofectamine(R) 2000 reagent (ThermoFisher Scientific), according to the manufacturer's protocol. The Smart Quant Green master mix for real‐time quantitative PCR assay was purchased from Protech (Taipei, Taiwan).

Jheng J., Chen Y., Ao U.I., Chan D., Huang J., Hung K., Tarng D, & Chiang C. (2018). The double‐edged sword of endoplasmic reticulum stress in uremic sarcopenia through myogenesis perturbation. Journal of Cachexia, Sarcopenia and Muscle, 9(3), 570-584.

+ Open protocol

+ Expand

Yeast Genetic Manipulation Reagents

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genotypes of strains and yeast plasmids used in this work are listed in Supplementary Table 3 and4. All chemicals used in this study were purchased analytical grade from either Sigma Aldrich or Carl Roth except for the following: Drop Out Mix for yeast synthetic medium was from US Biological Life Sciences (D9543-01). 5-FOA was bought from Cayman Chemical (17318). Ampure XP beads were from Beckman Coulter (A63881), Protein-G coupled dynabeads from Thermo Fisher (10009D) and Thiolutin from Abcam (ab143556). Secondary antibodies against rabbit (7074S) and mouse (7076S) IgG coupled to HRP were purchased from Cell Signaling. Antibodies against H3K56ac were from Active Motif (39281), G6PDH (A9521) and c-Myc (MABE282) from Sigma, iAID-tag (M214-3) from MBL International and βactin (GTX109639) from GeneTex.

Kochan D.Z., Mawer J.S.P., Tishinov K., Parekh S., Massen J., Graef M., Spang A., & Tessarz P. (2020). The RNA-binding protein Puf5 buffers mRNA levels against chromatin-mediated changes in nascent transcription.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!