Hispec buffer

To confirm the transcriptome results, the 23 analyzed miRNA were validated by qRT‐PCR. Complementary DNA synthesis from miRNA samples was performed using the miScript II RT Kit and HiSpec Buffer (Qiagen). The obtained cDNA was subjected to the RT‐PCR in the ABI 7500 fast sequence detection system (Applied Biosystems, Thermo Fisher Scientific), using the BRYT‐Green based PCR reaction. PCR amplification was performed in a total reaction mixture of 20 μL, containing 20 ng cDNA, 10 μL 2× GoTaq1qPCR Master Mix (Promega, Madison, WI, USA) and 0.2 μm of each primer. The PCR was run with the standard thermal cycle conditions using the two‐step qRT‐PCR method: an initial denaturation at 95 °C for 30 s, followed by 40 cycles of 30 s at 95 °C and 30 s at 60 °C. Each reaction was run in triplicate, considering all selected time points (1, 2, 4 and 6 h), and the average threshold cycle (C_t) was calculated for each replicate. The expression of miRNAs was calculated relative to the expression level of the endogenous control U6, and the relative expression of a gene was calculated using the 2−ΔΔCt method. The correlation of the fold‐change of the gene expression ratios between qRT‐PCR and RNA‐Seq was checked by linear regression analysis in spss Statistics v24.0 software (IBM Corp., Armonk, NY, USA).

Using the miScript II RT kit (Qiagen) with HiSpec Buffer (Qiagen) to focus on mature miRNAs with oligo-dT primers, we reverse-transcribed 100 ng of total RNA. Next, the cDNA was amplified with miScript PreAMP PCR kit (Qiagen). The PCR was then performed with the miScript SYBR Green PCR kit (Qiagen) on a Mx3000P Q-PCR system (Agilent Technologies), according to the manufacturer’s instructions. The PCR miScript Primer Assays (Qiagen) of let-7f (MIMAT0000067), miR-199a-3p (MIMAT0000232), miR-1207-5p (MIMAT0005871), miR-21 (MIMAT0000076), miR-24 (MIMAT0000080), miR-29a (MIMAT0000086), miR-29b (MIMAT0000100), miR-29c (MIMAT0000681), miR-34a (MIMAT0000255), miR-451 (MIMAT0001631), and RNU6-2 were used for q-RT-PCR.

RT-qPCR reactions were performed and reported according to the MIQE guidelines [45 (link)]. For quantification of individual miRNA expressions, cDNA was synthesized from 500 ng total RNA with 4 μl of HiSpec Buffer, 2 μl of Nucleics Mix and 2 μl miScript RT Mix (miScript II RT Kit, Qiagen; 218161) in a final volume of 20 μl. This reaction mix was incubated for 60′ at 37°C and 5′ at 95°C using an iCycer instrument (Bio-Rad). qPCR reactions contained 3 ng of cDNA, 2.5 μl QuantiTeckt Mastermix, 0.5 μl miScript Universal Primer and 0.5 μl miRNA-specific miScript Primer Assay (Qiagen, miScript Primer Assays used are listed in Supplementary Table S2) in a total volume of 5 μl. Expression levels were normalized against three stably expressed reference miRNAs (hsa-miR-125a, hsa-miR-423 and hsa-miR-92) validated with GeNorm [46 ] and analyzed using qbase+ software version 2.6 (http://www.biogazelle.com/qbaseplus) [47 (link)].

First strand cDNA synthesis was performed using miScript II RT kit (Qiagen, GmbH, Hilden, Germany) according to the manufacturer; 9 µl of miRNA sample was used in a total of 20 µl reactions (4 µl of 5 × miScript HiSpec buffer, 2 µl of 10 × miScript Nucleics mix, 2 µl of transcriptase Mix and 3 µl of RNase-free water). The quality control of cDNA samples was performed by miScript miRNA QC PCR array system (MIHS-989ZC-1) using miScript AYBR Green PCR kit (Qiagen, GmbH, Hilden, Germany). The control conditions are the following: C. elegans miR-39, miR-16, miR-21, miR-191, snoRNA (SNORD 61, 95 and 96), negative and positive PCR control. This system permits to check if there are reverse transcription inhibitors, PCR amplification efficiency, and DNA contamination^{24 (link)}.

The complementary DNA (cDNA) synthesis from total RNA was carried out using the RT² First Standard Kit (Cat. No. 330401) (Qiagen Sciences, Maryland 20874, USA). Prior to cDNA synthesis, a genomic elimination reaction was performed, according to manufactures instructions. Briefly, 2 μL of GE buffer were added to 400 ng of RNA in a final reaction volume of 10 μL. The reactions were incubated 5 min at 42°C in a SureCycler 8800 (Agilent, Santa Clara, CA, USA) and then kept on ice for 5 min. For the reverse transcription, all the genomic DNA elimination mix was converted into cDNA adding 10 μL of the reverse transcription mix and incubated for 15 minutes at 42°C and 5 minutes at 95°C. Then 91 μL of RNase free water were added to the reactions and mixed by pipetting. The reactions were kept at -20°C until the development of the real-time PCR Arrays. miRNA cDNA synthesis was performed with miScript II RT cDNA synthesis kit using Hispec buffer (Qiagen, Valencia, CA, USA), following the manufacturer instructions.

Total RNA including miRs was extracted from cells with miRNeasy micro kit (Qiagen, Hilden, Germany). Total RNA (200 ng) was reverse‐transcribed with Hispec buffer according to the manufacturer's protocol for quantitative RT–PCR (Qiagen). The primer sequences for miR‐195 and miR‐195‐5p inhibitor for quantitative RT–PCR were as follows: miR‐195, forward 5′‐ACACTCCAGCTGGGTAGCAGCACAGAAAT‐3′ and universal 5′‐CCAGTGCAGGGTCCGAGGTA‐3′: miR‐195‐5p inhibitor, forward 5′‐CCCACAACGAGGACTACA‐3′ and reverse 5′‐CGTGAAGAATGTGCGAGAC‐3′. The primer sequences for Sirt1, Tert, and Gapdh gene used for RT–PCR were as follows: Sirt1 gene, forward 5′‐TTGTGAAGCTGTTCGTGGAG‐3′ and reverse 5′‐GGCGTGGAGGTTTTTCAGTA‐3′; Tert gene, forward 5′‐CTGCGTGTGCGTGCTCTGGAC‐3′ and reverse 5′‐CACCTCAGCAAACAGCTTGTTCTC‐3′; and Gapdh gene, forward 5′‐TGGCCTTCCGTGTTCCTACC‐3′ and reverse 5′‐TGTAGGCCATGAGGTCCACCAC‐3′. A pair of PCR primers for U6 and SYBR Green probes was purchased from Qiagen. Reactions were completed in triplicate for each sample and were analyzed using the CFX touch real‐time PCR detection system (Bio‐Rad Laboratories, Hercules, CA USA). Data were normalized to GAPDH or U6 levels. For the detection of miRs, the cDNA for each sample was mixed with a universal primer, a forward primer, and probes obtained from Qiagen.

RNA was isolated from cell-free urine using the miRNeasy Serum/Plasma Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions by the use of a QIAcube robotic workstation for automated RNA extraction. The exogenous Cel-miR-39 spike-in (Qiagen) was added in equal concentrations to all samples prior to RNA isolation to monitor the efficiency of RNA extraction. Total RNA was eluted in 15 μL of RNase-free water and stored at −80 °C until further use.
Before performing real-time PCR, 2 μL RNA from each sample were retro-transcribed using the miScript II RT Kit and HiSpec Buffer (Qiagen). cDNA was then diluted 10 folds and assayed in 10 μL PCR reactions; miR-27b-3p was assayed in duplicate by qPCR using the miScript SYBR Green PCR Kit and the following primer pair: hsa-miR-27b-3p miScript Primer Assay (cat. No. MS00031668). Amplification was performed using the LightCycler^® 96 Real-Time PCR System (Roche Diagnostics, Indianapolis, IN, USA) in 96-well plates.