Simpliamp thermocycler

Manufactured by Thermo Fisher Scientific

Sourced in United States, United Kingdom

The SimpliAmp thermocycler is a compact and efficient instrument designed for performing polymerase chain reaction (PCR) amplification. It offers precise temperature control and consistent thermal cycling for reliable and reproducible results. The SimpliAmp thermocycler is a versatile tool for a variety of molecular biology applications.

Automatically generated - may contain errors

Lab products found in correlation

20 protocols using simpliamp thermocycler

Multiplex miRNA Expression Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA synthesis was performed in 4 multiplex pools. For each pool, 50 ng of the extracted RNAs was reverse transcribed to cDNAs (25 °C for 10 min, 30 °C for 10 min, 35 °C for 10 min, 40 °C for 10 min, followed by 95 °C for 5 min) by conformational restricted miRNA specific-RT primers and the ID3EAL cDNA Synthesis System (MiRXES) on a SimpliAmp thermocycler (Applied Biosystems). cDNAs were subsequently split into 8 multiplex pools and preamplified ( 25 °C for 10 s, 95 °C for 10 min, 40 °C for 5 min, followed by 8 cycles of 95 °C for 10 s and 60 °C for 30 s) by the ID3EAL miRNA Augmentation System (MiRXES) using SimpliAmp thermocycler (Applied Biosystems). qPCR master mix was added to preamplified cDNAs from each sample and precisely aliquoted to the ID3EAL PanoramiR microRNA Knowledge Panel (MiRXES, FGS0003) via the Integra Assist Plus liquid handler, prior to quantitative PCR (qPCR)-based miRNA expression profiling using the QuantStudio 5-384-well qPCR system (Applied Biosystems).
Upon the completion of miRNA expression profiling, raw threshold cycle (Ct) values were determined using the QuantStudio Design and Analysis software with automatic baseline and threshold settings. Technical variations introduced during RNA isolation and the process of RT-qPCR were normalized using the spike-in control RNA (ID3EAL PanoramiR Spike-in RNA Template, MiRXES).

Bin Masroni M.S., Ling Eng G.W., Jeon A.J., Gao Y., Cheng H., Leong S.M., Cheong J.K., Hue S.S, & Tan S.Y. (2024). MicroRNA expression signature as a biomarker in the diagnosis of nodal T-cell lymphomas. Cancer Cell International, 24, 48.

+ Open protocol

+ Expand

Estimating Wolbachia Infection Frequencies

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To test for Wolbachia frequency variation, we extracted DNA from many individuals from each collection using a standard squish buffer protocol and identified Wolbachia infections using polymerase chain reaction (PCR) (Simpliamp ThermoCycler; Applied Biosystems, Singapore) (Meany et al., 2019 (link)). We amplified the Wolbachia surface protein (wsp) (Braig et al., 1998 (link)) and arthropod‐specific 28S rDNA, which served as a positive control (Baldo et al., 2006 (link)) (Table S2). PCR products were visualized using 1% agarose gels. Assuming a binomial distribution, we estimated exact 95% confidence intervals for Wolbachia frequencies for each collection. We used Fisher's exact test (FET) to determine differences in frequencies among sites, between years, between sexes, and between color forms.

Wheeler T.B., Thompson V., Conner W.R, & Cooper B.S. (2021). Wolbachia in the spittlebug Prosapia ignipectus: Variable infection frequencies, but no apparent effect on host reproductive isolation. Ecology and Evolution, 11(15), 10054-10065.

+ Open protocol

+ Expand

16S rRNA Gene Amplification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

The extracted DNA was then subjected to amplification in a Simpli Amp Thermocycler (Applied Biosystems, Waltham, MA, USA).
We evaluated one ribosomal marker of full length 16 S rRNA gene. The DNA containing the target bacteria was amplified to target the 16SrRNA gene using the 16–27 F (TTTCTGTTGGTGCTGATATTGCAGAGTTTGATCMTGGCTCAG) and 16 S-1492R (ACTTGCCTGTCGCTCTATCTTCGGTTACCTTGTTACGACTT) primer sets. All the primers contained the Oxford Nanopore tag which is an overhang that allows barcoding the sample during the second barcoding PCR. The mixture for the full length 16SrRNA gene (25μL total volume) contained 10ng of DNA template, 5X LongAmp Taq buffer, 0.3mM dNTPs, 0.4 μM of each primer and 0.5 units of LongAmp Taq DNA Polymerase (New England BioLabs). The PCR conditions were: denaturization of 30 s at 98^oC followed by 35 cycles of 15 s at 98^oC, 15 s at 51^oC, 45 s at 72^oC and a final step of 7 min at 72 ^oC and then hold at 4⁰C. The amplicons were then run on a 2% gel stained with 1 μg/mL of ethidium bromide and viewed under U.V light in a viewer box (Vilber E-box, Vilber, Deutschland GmbH. Wielandstrasse 2, Germany).

Kiryowa H.M., Buwembo W., Munabi I.G., Mwaka E.S., Rwenyonyi C.M., Kaddumukasa M, & Kiguli S. (2024). A comparison of oral bacteriome isolated from periodontal pockets of participants with or without diabetes mellitus in Uganda: a case control study. BMC Research Notes, 17, 146.

+ Open protocol

+ Expand

RNA Extraction and Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

CTSCs RNA extraction and purification were completed using manufacturer’s instructions (Qiagen, Germantown, MD, USA). After RNA quantification (Nanodrop), cDNA was created using iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA). Amplification was conducted using SimpliAmp thermocycler (Applied Biosystems, Waltham, MA, USA). Real-time polymerase chain reaction (RT-PCR) was conducted by running samples on StepOnePlus RT-PCR System (Applied Biosystems). Primers were created from Life Technologies, and the sequences are included in the Table S1.

Kurian J., Bohl V., Behanan M., Mohsin S, & Khan M. (2021). Transcriptional Profiling of Cardiac Cells Links Age-Dependent Changes in Acetyl-CoA Signaling to Chromatin Modifications. International Journal of Molecular Sciences, 22(13), 6987.

+ Open protocol

+ Expand

Quantification of Irg1 Expression in Neutrophils

Check if the same lab product or an alternative is used in the 5 most similar protocols

Irg1 expression was assessed by qRT-PCR. Neutrophils were resuspended in RPMI +10% hiFBS to a concentration of 5 × 10⁵ cells/mL, transferred to Eppendorf tubes in 1 mL aliquots, and infected with LAC at a MOI of 10. The same volume of vehicle (PBS) was added to uninfected controls. The cells were incubated at 37°C. At 4 and 20 h, 500 μL aliquots were centrifuged at 500 xg for 5 min at 4°C. The supernatant was saved for metabolomic analysis (described below) and the cell pellet was processed for RNA isolation.
RNA was isolated using the E.Z.N.A. Total RNA Kit. Cells were incubated in TRK lysis buffer for 10 min at room temperature before adding 70% ethanol. These samples were transferred to E.Z.N.An RNA isolation columns and RNA was isolated following manufacturer’s instructions. DNA was selectively degraded using the DNA-free DNA removal kit and cDNA was generated using a High Capacity cDNA Reverse transcription kit on a SimpliAmp thermocycler (Applied Biosystems). qRT-PCR was performed with PowerUp SYBR Green PCR Mastermix on a StepOnePlus Real-time PCR System (Applied Biosystems) using StepOne. Data were analyzed using the ΔΔC_T method using actin as a control housekeeping gene.

Verweij P.E., Weemaes C.M., Curfs J.H., Bretagne S, & Meis J.F. (2000). Failure To Detect Circulating Aspergillus Markers in a Patient with Chronic Granulomatous Disease and Invasive Aspergillosis. Journal of Clinical Microbiology, 38(10), 3900-3901.

+ Open protocol

+ Expand

Amplifying KRAS Proto-oncogene Fragment

Check if the same lab product or an alternative is used in the 5 most similar protocols

A 250 bp fragment of the proto-oncogene KRAS mRNA (accession number # NG_007524, nt 148-397) was cloned into the PCR2.1-TOPO TA cloning vector (plasmid KRAS-PCR2.1) (Eurofins Genomics). A 150 bp KRAS fragment was amplified from plasmid KRAS-PCR2.1 using Platinum PCR SuperMix High Fidelity kit (Invitrogen) and primers KRAS-FWD-(5′-GAGTGCCTTGACGATACAGCT) and KRAS-REV (5′-GCACTGTACTCCTCTTGACC). The resulting PCR product was sequenced to verify the specificity of the reaction. PCR reactions were performed on a SimpliAmp thermocycler (Applied Biosystems) with 25 thermocycles with the following temperature pattern: 95 °C, 55 °C and 68 °C each for 30 seconds. Tetronic 1307 (BASF, stock at 5% weight in water) was added at a final concentration of 1% weight in PCR reactions when used.

Scanga R., Chrastecka L., Mohammad R., Meadows A., Quan P.L, & Brouzes E. (2018). Click chemistry approaches to expand the repertoire of PEG-based fluorinated surfactants for droplet microfluidics. RSC Advances, 8(23), 12960-12974.

+ Open protocol

+ Expand

RNA Extraction and cDNA Synthesis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNAs of the magnetic sorted cells were extracted using the RNeasy Plus Mini Kit (Qiagen, Germany), For each sample, 4 µg pf RNA was reverse-transcribed to cDNA using the High capacity cDNA reverse transcription kit (Applied Biosystems, Lithuania) according to manufacturer’s instructions. RT was carried out in 0.5 mL tubes (Easy strip Snap Tubes, Thermo Fisher Scientific, UK) in a SimpliAmp Thermocycler (Applied Biosystems), using the following program: 10 min at 25 °C, 120 min at 37 °C, 5 min at 85 °C, followed by a cooling step at 4 °C.

Arakelian L., Lion J., Churlaud G., Bargui R., Thierry B., Mutabazi E., Bruneval P., Alberdi A.J., Doliger C., Veyssiere M., Larghero J, & Mooney N. (2023). Endothelial CD34 expression and regulation of immune cell response in-vitro. Scientific Reports, 13, 13512.

+ Open protocol

+ Expand

Upregulation of Regeneration Genes in DRG Explants

Check if the same lab product or an alternative is used in the 5 most similar protocols

DRG explants grown for 48 h in an NT3-stimulated ASCs conditioned medium (CM-NT3-ASC), unstimulated ASCs conditioned medium (CM-ASC), NT3-supplemented GM (NT3), and GM only (GM) were evaluated for the upregulation of the regeneration-associated genes STAT-3 and GAP-43. β-Actin was used as the housekeeping gene. A total of 500 ng RNA per sample was converted into cDNA following the protocol for the SuperScript™ IV VILO™ Master Mix with ezDNase™ Enzyme (Invitrogen™, Cat. No. 11766050) and using the SimpliAmp™ Thermocycler (Applied Biosystems™, CA, USA, Cat. No. A24811 by Life Technologies, Thermo Fisher Scientific AG, Basel, Switzerland). Amplification was performed with the QuantStudio™ 3 Real-Time PCR Systems (Applied Biosystems, Thermo Fisher Scientific AG) using a Fast Start Universal SYBR Green Master Mix (Roche, Cat. No. 04 913 850 001). Twenty nanograms of cDNA were used per well. The primers used are listed in Figure 4B and were designed for the species Gallus gallus. All reactions were performed using the same conditions: 50 °C for 2 min, 95 °C for 10 min; 40 cycles at 95 °C for 15 s, 60 °C for 1 min. The experiment was repeated three times and all experimental samples were assayed in triplicate. A negative control (RNase-free water) was always included. The expression levels of STAT-3 and GAP-43 were determined in relation to the β-actin RNA levels.

Prautsch K.M., Schmidt A., Paradiso V., Schaefer D.J., Guzman R., Kalbermatten D.F, & Madduri S. (2020). Modulation of Human Adipose Stem Cells’ Neurotrophic Capacity Using a Variety of Growth Factors for Neural Tissue Engineering Applications: Axonal Growth, Transcriptional, and Phosphoproteomic Analyses In Vitro. Cells, 9(9), 1939.

+ Open protocol

+ Expand

Viral RNA to cDNA Conversion Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Complementary DNA (cDNA) synthesis was performed in a 20 µL reaction containing 4 µL of 5× SuperScript IV VILO MasterMix (Invitrogen, Carlsbad, CA, USA), 12 µL of nuclease-free water and 4 µL of the viral RNA template, as per the manufacturer’s instructions. The thermal cycling protocol used was as follows: random priming was performed at 25 °C for 10 min, followed by extension at 50 °C for 20 min and then enzyme denaturation at 85 °C for 5 min before holding at 4 °C. All incubation steps and reaction components were performed to the manufacturer’s specifications on a SimpliAmp thermocycler (Applied Biosystems, Foster City, CA, USA). Viral cDNA was used immediately or stored at −80 °C until required.

Tulloch R.L., Kok J., Carter I., Dwyer D.E, & Eden J.S. (2021). An Amplicon-Based Approach for the Whole-Genome Sequencing of Human Metapneumovirus. Viruses, 13(3), 499.

+ Open protocol

+ Expand

Gene Expression Analysis of Immortal Astrocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from in vitro astrocytes using Trizol (Thermofisher) according to manufacturer’s instructions. Briefly, E2, E3, and E4 immortal astrocytes under identical culture conditions in maintenance media were washed and treated with Trizol for 5 minutes to accomplish nucleoprotein complex dissociation. Chloroform was then added and samples were centrifgued at 12,000×g for 15 minutes to separate RNA from the lower organic phase. RNA was precipitated with addition of isopropanol, washed with 75% ethanol and dried briefly. RNA pellets were resuspended in 50uL of RNAse free water. Total RNA was reverse transcribed to cDNA using the High Capacity RNA-to-cDNA Kit (Applied Biosystems) on a SimpliAmp Thermocycler (Applied Biosystems). cDNA was quantified by NanoDrop and loaded at 100ng/well into a custom Taqman Gene Array plate with 2X Taqman Fast Advanced Mastermix and sealed with MicroAmp™ Optical Adhesive Film. Taqman qRT-PCR was performed over 40 cycles on a QuantStudio 3 Flex Real-Time PCR System under the following cycle conditions: enzyme activation at 95°C for 20 seconds, denaturation at 95°C for 1 second, and annealing and extension at 60°C for 20 seconds. Ct values were normalized to housekeeping gene 18S for each plate to obtain ΔCt values. Gene expression differences were found by comparing to 2-ΔCt values and expressed as percentage of the mean of E3 samples.

Williams H.C., Farmer B.C., Piron M.A., Walsh A.E., Bruntz R., Gentry M., Sun R.C, & Johnson L.A. (2020). APOE alters glucose flux through central carbon pathways in astrocytes. Neurobiology of disease, 136, 104742.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!