Log In Sign up
The largest database of trusted experimental protocols

Monophosphoryl lipid a

Manufactured by InvivoGen
Visit Supplier
Sourced in United States

Monophosphoryl Lipid A is a purified derivative of lipopolysaccharide from Salmonella Minnesota R595. It acts as a Toll-like receptor 4 (TLR4) agonist, stimulating the innate immune system.

Automatically generated - may contain errors

Lab products found in correlation

Quil a, by InvivoGen (3 mentions) Female balb c mice, by Jackson ImmunoResearch (2 mentions) Dulbecco s phosphate buffered saline dpbs, by Thermo Fisher Scientific (2 mentions) Ultrapure lps escherichia coli 0111 b4, by InvivoGen (2 mentions) Trehalose dihydrate, by Merck Group (1 mentions) Swiss webster mice, by Charles River Laboratories (1 mentions) Igg2a, by Thermo Fisher Scientific (1 mentions) Alhydrogel, by InvivoGen (1 mentions) Imiquimod r837, by InvivoGen (1 mentions) Cfa ifa, by Merck Group (1 mentions) Muramyl dipeptide mdp, by InvivoGen (1 mentions) Resiquimod r848, by InvivoGen (1 mentions) Cpg odn 1826, by InvivoGen (1 mentions) Flow cytometry reagent, by BD (1 mentions) Cell culture reagents, by Merck Group (1 mentions) Alhydrogel adjuvant 2 alum, by InvivoGen (1 mentions) Elisa kit, by R&D Systems (1 mentions) Montanide isa 720 vg, by Seppic (1 mentions) Clotting activator serum collection tubes, by Sarstedt (1 mentions) Female c57bl 6 mice, by Charles River Laboratories (1 mentions)

8 protocols using monophosphoryl lipid a

1

Immunization of Balb/c Mice with Antigen

Check if the same lab product or an alternative is used in the 5 most similar protocols
Balb/c female mice (6–8
weeks old) were procured from The Jackson Laboratory. All mice were
maintained at Stanford University according to the Public Health Service
Policy for “Humane Care and Use of Laboratory Animals”
following a protocol approved by Stanford University Administrative
Panel on Laboratory Animal Care (APLAC-33709). Mice were immunized
via subcutaneous injection of 10 μg of antigen with the exception
of SΔC-Fer dosing and longevity studies in which animals were
immunized with either 0.1, 1, 10, or 20 μg as specified in Figure S10. All antigen doses were formulated
with 10 μg of Quil-A (InVivogen) and 10 μg of monophosphoryl
lipid A (InVivogen) diluted in 1× Dulbecco’s phosphate-buffered
saline (DPBS) (Gibco) in a total volume of 100 μL per injection.
Mice were immunized at day 0 and day 21. Serum was collected at days
0, 21, and 28 and processed using Sarstedt serum collection tubes.
Day 0 serum was analyzed for both ELISA binding and lentiviral neutralization
and showed no evidence of binding or neutralizing activity (data not
shown).
Powell A.E., Zhang K., Sanyal M., Tang S., Weidenbacher P.A., Li S., Pham T.D., Pak J.E., Chiu W, & Kim P.S. (2021). A Single Immunization with Spike-Functionalized Ferritin Vaccines Elicits Neutralizing Antibody Responses against SARS-CoV-2 in Mice. ACS Central Science, 7(1), 183-199.
+ Open protocol
+ Expand
2

Zika Virus Vaccine Delivery via Microneedles

Check if the same lab product or an alternative is used in the 5 most similar protocols
The Zika virus strain PRVABC59 with a viral titer of 1 × 106 PFU/mL was kindly supplied by Brandy Russell, Centers for Disease Control and Prevention (CDC), Colorado. The polymer poly (D, L-lactide-co-glycolide) 75:25 (PLGA) (Resomer® RG 752 H) was procured from Evonik Corporation (Birmingham, AL, USA). Adjuvants, Alhydrogel® and Monophosphoryl Lipid A (MPL-A®), were purchased from InvivoGen (San Diego, CA, USA). Sodium hyaluronate (HA) (100 kDa) was purchased from Lifecore Biomedical (Chaska, MN, USA). Trehalose dihydrate and polyvinyl alcohol (PVA) (Avg Mol Wt. 30,000–70,000) were procured from Sigma-Aldrich (St. Louis, MO, USA). The 10 × 10 array poly dimethyl siloxane (PDMS) microneedle templates were obtained from Micropoint Technologies (Singapore, Singapore). Methylene blue dye was purchased from Fischer Scientific (Hampton, NH, USA). Swiss Webster mice (6–8 weeks old, male) for in vivo efficacy evaluation were purchased from Charles River Laboratories (Wilmington, MA, USA). Goat anti-mouse secondary IgG, IgG2a, and IgG1 conjugated to Horseradish Peroxidase (HRP) were purchased from Invitrogen™ (Rockford, IL, USA). Allophycocyanin (APC)-labeled anti-mouse CD4 antibody and fluorescein isothiocyanate (FITC)-labeled anti-mouse CD8a antibody were purchased from Invitrogen™, Thermo Fisher Scientific (Waltham, MA, USA).
Kale A., Joshi D., Menon I., Bagwe P., Patil S., Vijayanand S., Braz Gomes K., Uddin M.N, & D’Souza M.J. (2023). Zika Vaccine Microparticles (MPs)-Loaded Dissolving Microneedles (MNs) Elicit a Significant Immune Response in a Pre-Clinical Murine Model. Vaccines, 11(3), 583.
+ Open protocol
+ Expand
3

Adjuvant Evaluation for gp140 Immunization

Check if the same lab product or an alternative is used in the 5 most similar protocols
The trimer gp140 was diluted in saline and emulsified/mixed with the following adjuvants: i) 1 mg Monophosphoryl Lipid A (InvivoGen), ii) Complete/ Incomplete Freund’s adjuvant (CFA/IFA, Sigma) according to manufacturer specifications, iii) 50 μg polyinosine-polycytidyl IC- poly (I:C) (InvivoGen), iv) 20 μg Imiquimod- R837 (InvivoGen), v) 20 μg Resiquimod- R848 (InvivoGen), vi) 10 μg Muramyl dipeptide (MDP)- (InvivoGen), vii) 1mg aluminiun hydroxide gel (Sigma), viii) 20 μg Ribi (Sigma) and ix) 10 μg CpG ODN 1826 (TCCATGACGTTCCTGACGTT) synthesized with a nuclease-resistant phosphorothioate backbone (InvivoGen). In animals that received the first dose with Complete Freund’s adjuvant (CFA, Sigma), the booster injections were provided with antigen emulsified in IFA. The control groups received the adjuvant alone or the recombinant protein diluted in PBS.
Apostólico J.D., Boscardin S.B., Yamamoto M.M., de Oliveira-Filho J.N., Kalil J., Cunha-Neto E, & Rosa D.S. (2016). HIV Envelope Trimer Specific Immune Response Is Influenced by Different Adjuvant Formulations and Heterologous Prime-Boost. PLoS ONE, 11(1), e0145637.
+ Open protocol
+ Expand
4

Immunological Reagents and Adjuvants

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell culture reagents were procured from Sigma-Aldrich (USA) unless otherwise mentioned; ELISA kits were procured from R&D Biosystems. Flow cytometry reagents and antibodies were from BD Biosciences and Santa Cruz, respectively, unless specified. Monophosphoryl Lipid-A and Alhydrogel® adjuvant 2% (alum) were purchased from In vivogen. Montanide ISA720VG, originally procured from SEPPIC, France, was a kind gift from Dr. S. N Singh, Biovet Pvt. Ltd.
Varma V.P., Kadivella M., Kumar A., Kavela S, & Faisal S.M. (2022). LigA formulated in AS04 or Montanide ISA720VG induced superior immune response compared to alum, which correlated to protective efficacy in a hamster model of leptospirosis. Frontiers in Immunology, 13, 985802.
+ Open protocol
+ Expand
5

Ex Vivo Whole Blood Stimulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The assay used in this study is a modified version of the procedure previously described43 (link). Ultrapure LPS (Escherichia coli 0111:B4) and monophosphoryl lipid-A (Salmonella minnesota) were purchased from Invivogen. Whole blood collected in EDTA vacutainers was diluted 1:4 with RPMI 1640 medium and 195 µl aliquots were transferred to 96-well, round-bottom micro-titre plates. Agonists were diluted in RPMI 1640 and 5 µl were applied to the wells at the following final concentrations: LPS, 1,000–10 ng ml−1; lipid-A, 10–1 µg ml−1. Suspensions were then mixed by pipet and incubated at 37 ° C, 5% CO2 for 4 h). After incubation, plates were centrifuged at 700 r.p.m. for 10 min, and 120 µl of cell-free supernatant was removed and stored at −80 °C until the assay was carried out. Each TLR ligand at a given concentration was performed in triplicate for each animal.
Palesch D., Bosinger S.E., Tharp G.K., Vanderford T.H., Paiardini M., Chahroudi A., Johnson Z.P., Kirchhoff F., Hahn B.H., Norgren RB J.r., Patel N.B., Sodora D.L., Dawoud R.A., Stewart C.B., Seepo S.M., Harris R.A., Liu Y., Raveendran M., Han Y., English A., Thomas G.W., Hahn M.W., Pipes L., Mason C.E., Muzny D.M., Gibbs R.A., Sauter D., Worley K., Rogers J, & Silvestri G. (2018). Sooty mangabey genome sequence provides insight into AIDS resistance in a natural SIV host. Nature, 553(7686), 77-81.
+ Open protocol
+ Expand
6

Immunization and Serological Analysis of Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
Female C57BL/6 mice (8 weeks old) were obtained from Charles River and maintained at Stanford University according to the Public Health Service Policy for “Human Care and Use of Laboratory Animals” following a protocol approved by the Stanford University Administrative Panel on Laboratory Animal Care (APLAC-32109). Mice were immunized at day 0 with 5 µg GP antigen (GP-Fer, GP-E2p, or GP-GCN4, n = 5 per group) adjuvanted with 10 µg monophosphoryl lipid A (Invivogen) and 10 µg Quil-A (In vivogen) via subcutaneous injection (100 µL per injection). Adjuvants were mixed with antigen immediately prior to injections. Mice were immunized with a second dose 18 weeks post primary immunization with 5 µg GP-GCN4 in DPBS as a proxy for viral challenge. At interim timepoints, blood was collected from the tail vein (collection time points shown in Figure 3A). Final bleeds were collected via cardiac puncture. Interim and final blood samples were processed using clotting activator serum collection tubes (Sarstedt) according to manufacturer’s recommendations. Serum was aliquoted and stored at -80°C until use.
Powell A.E., Xu D., Roth G.A., Zhang K., Chiu W., Appel E.A, & Kim P.S. (2022). Multimerization of Ebola GPΔmucin on protein nanoparticle vaccines has minimal effect on elicitation of neutralizing antibodies. Frontiers in Immunology, 13, 942897.
+ Open protocol
+ Expand
7

Antigen Immunization in Balb/c Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
Balb/c female mice (6–8 weeks old) were procured from The Jackson Laboratory. All mice were maintained at Stanford University according to Public Health Service Policy for ‘Humane Care and Use of Laboratory Animals’ following a protocol approved by Stanford University Administrative Panel on Laboratory Animal Care (APLAC-33709). Mice were immunized via subcutaneous injection of 10 μg antigen with 10 μg Quil-A (InVivogen) and 10 μg monophosphoryl Lipid A (InVivogen) diluted in 1X Dulbecco’s phosphate-buffered saline (DPBS) (Gibco) in a total volume of 100 μL per injection. Mice were immunized at day 0 and day 21. Serum was collected at Days 0, 21, and 28 and processed using Sarstedt serum collection tubes. Day 0 serum was analyzed for both ELISA binding and lentiviral neutralization and showed no evidence of binding or neutralizing activity (data not shown).
Powell A.E., Zhang K., Sanyal M., Tang S., Weidenbacher P.A., Li S., Pham T.D., Pak J.E., Chiu W, & Kim P.S. (2020). A single immunization with spike-functionalized ferritin vaccines elicits neutralizing antibody responses against SARS-CoV-2 in mice. bioRxiv.
+ Open protocol
+ Expand
8

Ex Vivo Whole Blood Stimulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The assay used in this study is a modified version of the procedure previously described43 (link). Ultrapure LPS (Escherichia coli 0111:B4) and monophosphoryl lipid-A (Salmonella minnesota) were purchased from Invivogen. Whole blood collected in EDTA vacutainers was diluted 1:4 with RPMI 1640 medium and 195 µl aliquots were transferred to 96-well, round-bottom micro-titre plates. Agonists were diluted in RPMI 1640 and 5 µl were applied to the wells at the following final concentrations: LPS, 1,000–10 ng ml−1; lipid-A, 10–1 µg ml−1. Suspensions were then mixed by pipet and incubated at 37 ° C, 5% CO2 for 4 h). After incubation, plates were centrifuged at 700 r.p.m. for 10 min, and 120 µl of cell-free supernatant was removed and stored at −80 °C until the assay was carried out. Each TLR ligand at a given concentration was performed in triplicate for each animal.
Palesch D., Bosinger S.E., Tharp G.K., Vanderford T.H., Paiardini M., Chahroudi A., Johnson Z.P., Kirchhoff F., Hahn B.H., Norgren RB J.r., Patel N.B., Sodora D.L., Dawoud R.A., Stewart C.B., Seepo S.M., Harris R.A., Liu Y., Raveendran M., Han Y., English A., Thomas G.W., Hahn M.W., Pipes L., Mason C.E., Muzny D.M., Gibbs R.A., Sauter D., Worley K., Rogers J, & Silvestri G. (2018). Sooty mangabey genome sequence provides insight into AIDS resistance in a natural SIV host. Nature, 553(7686), 77-81.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!