Fla7000 typhoon scanner

RNA (50 nM) was incubated in the presence or absence of 10 mM N-methylisatoic anhydride (NMIA) (ThermoFisher) in 10 μl of buffer containing 30 mM Tris pH 7.5, 100 mM KCl and 2.5 mM MgCl₂ for 45 min at 37°C. RNA was subsequently phenol/chloroform extracted and ethanol precipitated. Modified bases were detected by inhibition of primer extension using 2.5 U AMV-RT in the presence of ³²P-labelled primer and 0.5 mM dNTPs. cDNA products were phenol/chloroform extracted and ethanol precipitated before being resolved on denaturing 6% polyacrylamide sequencing gels and detected by autoradiography using an FLA7000 Typhoon scanner (GE).

Primer extension inhibition assays were performed as described
^{12 (link)}. Briefly, 1 nM cap0 or VPg-linked RNA were incubated with 1.5 μM Ifit proteins for 10 minutes at 37°C in reactions containing 20 mM Tris pH 7.5, 100 mM KCl, 2.5 mM MgCl
₂, 1 mM ATP, 0.2 mM GTP, 1 mM DTT and 0.25 mM spermidine. RT was carried out using 2.5 U avian myeloblastosis virus (AMV) reverse transcriptase (Promega) and a
³²P-labelled primer in the presence of 4 mM MgCl
₂ and 0.5 mM dNTPs. Primer sequences used for RT were CCTGCTCAGGAGGGGTCATG (MNV-1), GTCATAACTGGCACAAGAAGG (FCV) and GTCGTGGGGTGCCAGAAATC (PSaV). Sequencing reactions were performed using the Sequenase Version 2.0 DNA Sequencing Kit (ThermoFisher) in the presence of
³⁵S-labelled ATP. cDNA products were resolved on 6% denaturing PAGE and detected by autoradiography using an FLA7000 Typhoon Scanner (GE).

For the 2′-O-methylation assay, 50 ng of Cy5-labeled primer (Sigma) was annealed to 40 nm RNA by heating to 75 °C for 5 min and snap-cooling on ice. Reverse transcription was carried out using 5 units of AMV reverse transcriptase (Promega) in 20 mm Tris-HCl, pH 7.5, 100 mm KCl, 0.5 mm dNTPs with 0–4 mm MgOAc. For IFIT binding experiments, 25 ng of Cy5-labeled primer was annealed to 10 nm RNA and then incubated with indicated concentrations of IFIT in 20-μl reactions containing 20 mm Tris-HCl, pH 7.5, 100 mm KCl, 2.5 mm MgCl₂, 1 mm ATP, 0.2 mm GTP, 1 mm DTT, 0.25 mm spermidine, 0.1 unit/μl RNaseOUT, and 0.5 mg/ml BSA. The reactions were incubated at 37 ˚C for 10 min before addition of 2.5 units of AMV reverse transcriptase (Promega), 4 mm MgCl₂, 0.5 mm dNTPs, and labeled primer, either Cy5 (Fig. S8A) or ³²P (PerkinElmer) (Fig. S8D). Reverse transcription reactions were incubated at 37 ˚C for 30 min and then stopped with 100 mm EDTA and 10% SDS. cDNA products were extracted with UltraPure phenol:chloroform:isoamylalcohol (25:24:1), pH 8, (ThermoFisher) and ethanol-precipitated. Pellets were resuspended in 91% formamide loading dye and boiled for 5 min at 75 °C for PAGE. cDNA products were separated by 6% denaturing PAGE on 35-cm sequencing gels for 30–60 min and then imaged directly on an FLA7000 Typhoon scanner (GE Healthcare).

Using the Flexi Rabbit Reticulocyte Lysate system (Promega), 8 nM cap0 or 20 ng/μL VPg-linked RNA was translated in the presence or absence of 1.5 μM Ifit proteins, including 5 uCi EasyTag™ L-[
³⁵S]-Methionine (Perkin-Elmer). After 90 min at 30°C, reactions were terminated by addition of 50 mM EDTA and 0.5 μg/μL RNaseA. Labelled proteins were separated by 12.5% PAGE and detected by autoradiography using an FLA7000 Typhoon Scanner (GE).

IFIT1/mRNA interaction was performed essentially as described previously (14 (link)) with minor modifications. Cap0-ZV or cap0-β-globin reporter mRNAs (1 nM) were incubated with IFIT1 or IFIT1 containing complexes (at concentrations indicated in figures) for 10 min at 37°C in 20 μl reactions containing 20 mM Tris pH 7.5, 100 mM KCl, 2.5 mM MgCl₂, 1 mM ATP, 0.2 mM GTP, 1 mM DTT, 0.25 mM spermidine and 0.5 mg/ml BSA. IFIT1/mRNA interaction was monitored by inhibition of primer extension using avian myeloblastosis virus reverse transcriptase (2.5 U) (Promega) and a ³²P-labeled primer in the presence of 4 mM MgCl₂ and 0.5 mM dNTPs. Full length and truncated cDNA products were separated in a denaturing 6% acrylamide gel and detected by autoradiography using an FLA7000 Typhoon Scanner (GE). Analysis was performed using Image-Quant TL.