Sybr green master mix kit

Reverse transcriptase (RT) microRNA real time PCR was performed to determine the efficiency of miR-92a inhibition by LNA-anti-miR. Briefly, the total cellular RNA was extracted 24, 48, and 72 hours post transfection, with a miRCURY RNA Isolation Kit™ (Exiqon, Denmark) and cDNA was synthesized with a Universal cDNA Synthesis Kit™ (Exiqon, Denmark). Real time PCR was performed by using the SYBR^® Green master mix Kit™ (Exiqon, Denmark) and specific miR-92a primers were obtained from Exiqon (product No: 1204258; Exiqon, Denmark). The ABI Step One Plus (ABI, USA) instrument was used for real time PCR experiments and the ΔΔCt method was used for data calculation.

Total small RNA was isolated from 500 μL of whole blood and 1500 μL RBC lysis buffer using Hybrid-RTM miRNA kit (GeneAll, Korea) according to the manufacturer’s instructions, and were quantified using a NanoDrop spectrophotometer. Reverse transcription (RT) miRNA real-time polymerase chain reaction (PCR) was performed to determine the quantity of miR-122 and miR-33a (26 (link)). Samples were adjusted to a concentration of 5 ng/μL using nuclease-free water. A 2 μL aliquot of miRNA was used for producing cDNA using the miRCURY LNATM Universal RT microRNA PCR kit (Exiqon, Copenhagen, Denmark). The RT-PCR reactions for the whole blood miRNA assays were performed in a 10 μL final volume containing 4 μL of diluted cDNA using the SYBR Green master mix kit (Exiqon, Copenhagen, Denmark) and specific miR-122 and miR-33a primers (miR-33a primer sequence:
GUGCAUUGUAGUUGCAUUGCA and miR-122 primer sequence UGGAGUGUACAAUGGUGUUUG)
UniSp6 RNA spike-in templates were used as the internal controls (artificial reference gene or housekeeping gene) for the assays of miR- 122 and miR-33a. The StepOnePlus TM Real-Time PCR Systems (AB Applied Biosystem, USA) instrument was used for RT-PCR assay. The relative expression level of miRNA was quantified using threshold cycle (Ct) values normalized against internal control using the following equation:
ΔCT = CT (target miR) − CT (endogenous control) (2)

Total RNA was extracted from tissue samples and RASFs using Qiagen miRNeasy Mini kit (Qiagen GmbH), according to the manufacturer's protocol. The cDNAs were synthesized depending on total RNA and a reverse transcription kit (Abcam, Canada). The reverse transcription protocol was as follows: 25˚C for 5 min, 55˚C for 15 min and 85˚C for 5 min. The amplification of cDNAs was performed using a SYBR^®-Green Master mix kit (Qiagen GmbH) on an Applied Biosystems 7500 Real-Time PCR system (Thermo Fisher Scientific, Inc.). The primers were as follows: miR-27a-3p forward, 5'-ACACTCCAGCTGGGTTCACAGTG GCTAAG-3' and reverse, 5'-AGGGCTTAGCTGCTTGTGA GCA-3'; TLR5 forward, 5'-TGCCACTGTTGAGTGCAAGTC-3' and reverse, 5'-ACCTGGAGAAGCCGAAGGTAA-3'; GAPDH forward, 5'-GACAGTCAGCCGCATCTTCT-3' and reverse, 5'-GCGCCCAATACGACCAAA-3'; U6 forward, 5'-GCTTCGGCAGCACATATACTAAAAT-3' and reverse, 5'-CGCTTCACGAATTTGCGTGTCAT-3'. The thermocycling conditions used were 95˚C for 10 min, followed by 40 cycles of 95˚C for 15 sec, 60˚C for 30 sec and 60˚C for 15 sec. The reaction was held at 74˚C for continuous for melting curve analysis. The relative expression levels of miR-27a-3p and TLR5 mRNA were calculated by 2^-ΔΔCT methods (24 (link)) with normalization to U6 small nuclear RNA (U6) and GAPDH, respectively. All PCR reactions were performed in triplicate.

Total RNA from cartilage tissues and LPS‐treated primary chondrocytes was isolated using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA). A reverse transcription kit (Abcam) and the SYBR Green Master Mix Kit (Qiagen, Hilden, Germany) were used to amplify special gene expression on the Applied Biosystems 7500 Real‐Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA). The expression level of DANCR and miR‐19a were calculated using comparative threshold cycle value (2^−ΔΔCt) method, compared with glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) and U6 small nuclear RNA (U6), respectively. Polymerase chain reaction (PCR) primers were as follows: DANCR:¹⁷ 5′‐GCGCCACTATGTAGCGGGTT‐3′ (sense) and 5′‐TCAATGGCTTGTGCCTGTAGTT‐3′ (antisense); U6: 5′‐CTCGCTTCGGCAGCACA‐3′ (sense) and 5′‐AACGCTTCACGAATTTGCGT‐3′ (antisense); GAPDH: 5′‐AAGAAGGTGGTGAAGCAGGC‐3′ (sense) and 5′‐TCCACCACCCTGTTGCTGTA‐3′ (antisense). The primers for miRNA‐19a‐3p (miR‐19a) were purchased from Qiagen. All experiments were performed in at least three wells, and relative gene expression was normalized to control groups (as unit 1).