Genomic DNA of the pooled diploid barcode library was extracted using the MasterPure Yeast DNA Purification Kit (epicentre #MPY80200). To completely remove RNA, an extra RNase treatment, DNA precipitation with isopropanol, and washing with 70% ethanol were added after the recommended protocol from the manufacturer. Double barcode amplicons were generated using a two-step PCR protocol22 (link). Briefly, a 5-cycle PCR with OneTaq polymerase (New England Biolabs) was performed in 60 reactions for the large double barcode library, amplifying ∼1,000 copies per unique lineage tag. The PCR products were then pooled and purified with PCR Cleanup columns (Qiagen) at six PCR reactions per column. A second 23-cycle PCR was performed with high-fidelity PrimerSTAR Max plolymerase (Takara) in 30 reactions, with 15 μl of cleaned product from the first PCR as template and 50 μl total volume per tube. PCR products from all reaction tubes were pooled and purified using a PCR Cleanup column (Qiagen) and eluted into 50 μl of water. The appropriate PCR band was isolated by E-Gel agarose gel electrophoresis (Life Technologies) and quantitated by Qubit fluorometry (Life Technologies). Sequencing was performed on an Illumina HiSeq 2500 with 25% PhiX DNA spike-in. The PhiX DNA was necessary to increase the read complexity for proper calibration of the instrument (see ref. 22 (link)).
Pcr clean up column
Manufactured by Qiagen
The PCR clean-up column is a laboratory equipment used for the purification of PCR (Polymerase Chain Reaction) amplified DNA fragments. It is designed to remove unwanted components, such as primers, nucleotides, and salts, from the PCR reaction mixture, leaving the desired DNA product.
Automatically generated - may contain errors
Lab products found in correlation
Masterpure yeast dna purification kit, by Illumina (2 mentions)
Phusion hf polymerase master mix, by Thermo Fisher Scientific (2 mentions)
Adenosine triphosphate (atp), by Roche (2 mentions)
Creatine kinase, by Roche (2 mentions)
Hiseq 2500, by Illumina (1 mentions)
Qubit fluorometry, by Thermo Fisher Scientific (1 mentions)
Onetaq polymerase, by New England Biolabs (1 mentions)
Calf intestinal alkaline phosphatase, by New England Biolabs (1 mentions)
Bamh1, by New England Biolabs (1 mentions)
Ez chip chromatin immunoprecipitation kit, by Merck Group (1 mentions)
Amplitaq gold pcr master mix, by Thermo Fisher Scientific (1 mentions)
Anti acetyl histone h3, by Merck Group (1 mentions)
Normal rabbit immunoglobulin g, by Santa Cruz Biotechnology (1 mentions)
Superscript 4, by Thermo Fisher Scientific (1 mentions)
Rna cleanup kit, by New England Biolabs (1 mentions)
Reaction cleanup kit, by Qiagen (1 mentions)
Novaseq platform, by Illumina (1 mentions)
Tapestation, by Agilent Technologies (1 mentions)
Kapa sybr fast qpcr mix, by Roche (1 mentions)
12 protocols using pcr clean up column
1
Pooled diploid barcode library DNA extraction
2
REMI Transfection for Hygromycin Selection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
REMI was performed essentially as previously described37 (link). To generate vectors bearing restriction-enzyme sites at DNA ends, the plasmid pHygTm(plus)/pG7 (containing a Hygromycin cassette) was cut with BamH1 (NEB), treated with calf intestinal alkaline phosphatase (NEB) and purified on PCR clean up columns (QIAGEN®). 4.5 × 106 cells per condition were transfected with 2 µg of BamH1-linearised construct with or without 20 units of the restriction-enzyme BamH1 (NEB). Electroporated cells were spread on four 140 mm plates with axenic HL5 media. 24 h after transfection, hygromycin (35 μg/ml) was added for 5 days. Afterwards, plates were washed with KK2, fixed with 3.7% formaldehyde and stained with Crystal Violet solution. Colonies were counted and REMI induction calculated as the ratio of colony numbers with and without BamH1. Graphs of data were constructed using Excel 2016.
3
Linear Transcription Template Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Linear transcription templates were synthesized by PCR using Phusion HF Polymerase master mix (Thermo) and oligonucleotides listed in Supplementary Table 1 . PCR reactions contained 5 nM of the indicated template oligo, and 0.5 μM of the indicated forward and reverse primers. PCR products were purified using Qiagen PCR-clean up columns prior to use in transcription reactions.
Promoter −35 elements, −10 elements and transcription start sites are in bold and underlined.
Promoter −35 elements, −10 elements and transcription start sites are in bold and underlined.
4
Linear Transcription Template Synthesis
5
Chromatin Immunoprecipitation of PPARγ in MIN6 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MIN6 cells were cultured with or without 10 μmol/L PIO for 48 h in a 10‐cm dish. We carried out the chromatin immunoprecipitation (ChIP) assay using an EZ‐ChIP chromatin immunoprecipitation kit (Merck Millipore, Billerica, MA, USA). After fixing with 1% formaldehyde, cells were lysed, briefly sonicated and immunoprecipitated at 4°C overnight. The following antibodies were used in the ChIP reactions: normal rabbit immunoglobulin G (Santa Cruz Biotechnology, Dallas, TX, USA), anti‐acetyl histone H3 (Merck Millipore) and anti‐peroxisome‐proliferator activated receptor (PPAR; Santa Cruz Biotechnology). We washed the ChIP reactions, and eluted chromatin based on the manufacturer’s protocol. Chromatin was purified with PCR clean up columns (Qiagen), and PCRs were carried out with AmpliTaq Gold PCR Master Mix (Thermofisher).
The following primers, designed for mouse genes, were used.
ADM‐P1 forward: 5′‐ CAAACTTGGCAAGCACTCAG‐3′
ADM‐P1 reverse: 5′‐ AATGGGCTAGGACACACTCC‐3′
ADM‐P2 forward: 5′‐ CAAACTTGGCAAGCACTCAG‐3′
ADM‐P2 reverse: 5′‐ ACGGGTACTCCAAATGAAGG‐3′
ADM‐P3 forward: 5′‐ AAACCCCAATTTCCAATTCAG‐3′
ADM‐P3 reverse: 5′‐ GAAGGGGAACCAGAACAACTC‐3′
The following primers, designed for mouse genes, were used.
ADM‐P1 forward: 5′‐ CAAACTTGGCAAGCACTCAG‐3′
ADM‐P1 reverse: 5′‐ AATGGGCTAGGACACACTCC‐3′
ADM‐P2 forward: 5′‐ CAAACTTGGCAAGCACTCAG‐3′
ADM‐P2 reverse: 5′‐ ACGGGTACTCCAAATGAAGG‐3′
ADM‐P3 forward: 5′‐ AAACCCCAATTTCCAATTCAG‐3′
ADM‐P3 reverse: 5′‐ GAAGGGGAACCAGAACAACTC‐3′
6
Amplifying STARR-Seq Transcripts from Transduced Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was purified from transduced cells (Qiagen #75144) and concentrated 7.5X using an RNA Cleanup Kit (NEB #T2040L). RNA was reverse transcribed according to manufacturer guidelines with STARR-Seq transcript–specific primers (Supplemental Table 1 ) with SuperScript IV (Invitrogen #18090010), using twice the recommended RNA input. cDNA was purified using a Reaction Cleanup Kit (Qiagen #28206) and amplified using custom STARR-Seq transcript–specific primers (Supplemental Table 1 ) as previously described [15 (link)]. Diluted Lenti-STARR-Seq plasmid ‘input’ control was amplified using an input concentration that yielded the same amplification cycle number as the STARR library for hCD4+ Donor I. PCR amplified library was purified using PCR cleanup columns (Qiagen #28206) and quantified for PE-150 bp sequencing (Novogene).
7
High-Throughput Yeast DNA Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted using the MasterPure Yeast DNA purification kit (Epicentre, MPY80200), and concentrations were measured by Qubit. A sub-sample (150 ng) was taken from each sample to serve as a template for four-cycle PCR in which the barcode region was linearly amplified, and the internal index and UMI were added (Fig 1G ). Five samples from this reaction were pooled on a Qiagen PCR clean-up column (Cat. 28104) and eluted in a 50 μL elution buffer. These samples were further cleaned by 1.8× Ampure XP beads (Cat. A63881). From each pool, 10 μL were used for a 12–17 cycles PCR using Illumina indexed primers. Samples were purified using 1.8× Ampure XP beads, and their quality was evaluated using Agilent Tape-station (Cat. 5067–5584) and Qubit concentration measurements (Cat. Q32853). All samples were diluted to a concentration of 0.5 ng/μL, and 10 μL of each diluted sample was used to create the final library. This sample was further diluted to a final concentration of 2 nM in a final volume of 100 μL. The library was sequenced at the Weizmann Institute of Science’s G-INCPM unit on an Illumina NovaSeq platform with the following cycles: 29|10|10|26.
8
Heterologous RPA Amplification Conditions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 7
RPA reactions were established using primers Apo300 and ApoB4 which amplify a roughly 300 base pair duplex product from human genomic DNA. The following conditions were employed: 50 mM Tris.acetate pH 8.3, 100 mM Potassium acetate, 14 mM Magnesium acetate, 50 mM Creatine phosphate (Calbiochem), 3 mM ATP (Roche), 200 micromolar dNTPs, 50 ng/μl creatine kinase (Roche), 200 ng/μl UvsX of KVP40, Aeh1 or Rb69, 32 ng/μl UvsY of KVP40, Aeh1 or T4 as indicated, 600 ng/μl Rb69 gp32 or T4 gp32, 30 ng/μl Bsu polymerase, 5% Carbowax 20M, 300 nM amplification primers. Reactions were established and left at 37° C. for 90 minutes. All samples contained 1000 copies of human genomic DNA containing the target sequence. The precise composition of each reaction with regard to species of gp32, UvsX and UvsY is indicated. Samples were cleaned by passage through a Qiagen PCR clean-up column and electrophoresed on a 2% agarose gel containing ethidium bromide. As shown in
9
RPA Amplification of Human Genomic DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 7
RPA reactions were established using primers Apo300 and ApoB4 which amplify a roughly 300 base pair duplex product from human genomic DNA. The following conditions were employed: 50 mM Tris.acetate pH 8.3, 100 mM Potassium acetate, 14 mM Magnesium acetate, 50 mM Creatine phosphate (Calbiochem), 3 mM ATP (Roche), 200 micromolar dNTPs, 50 ng/μl creatine kinase (Roche), 200 ng/μl UvsX of KVP40, Aeh1 or Rb69, 32 ng/μl UvsY of KVP40, Aeh1 or T4 as indicated, 600 ng/μl Rb69 gp32 or T4 gp32, 30 ng/μl Bsu polymerase, 5% Carbowax 20M, 300 nM amplification primers. Reactions were established and left at 37° C. for 90 minutes. All samples contained 1000 copies of human genomic DNA containing the target sequence. The precise composition of each reaction with regard to species of gp32, UvsX and UvsY is indicated. Samples were cleaned by passage through a Qiagen PCR clean-up column and electrophoresed on a 2% agarose gel containing ethidium bromide. As shown in
10
ChIP-seq for H3K9me in yeast
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP was performed by as previously described (66 (link)). Briefly, 50 ml of a log-phase yeast culture was cross-linked by adding 37% formaldehyde for 30 min. Cells were collected and sonicated by an Ultrasonic Processor. 1 µl of H3K9me antibody (Abcam ab1220) was used for immunoprecipitation. Immunoprecipitated DNA was purified using a PCR clean up column (Qiagen), and analyzed by PCR using primers listed in Additional file 12 : Table S9. The experiments were replicated in two or three independent biological repeats.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!