Pentr u6

We designed three pairs of cDNA oligonucleotides targeting ASPP2 mRNA expression, using web-based software from Invitrogen and InvivoGen Inc. After synthesis, we inserted these double-strand oligos into the vector pENTR/U6 (Invitrogen) and sequenced the resulting plasmids to ensure the shRNA construct targeted human ASPP2 expression or were scrambled, which were generated and designated as LV-shASPP2 and LV-shNon. Then, the plasmids were transfected into HCC-LM3 cells and gene silencing efficiency was validated 48 h after transfection by real-time PCR and Western blot. Details about lentivirial vector production and lentivirus infection can be found in the supplementary material.

Seven shRNAs targeting different regions of Chrono gene were designed. A nonspecific (NS) shRNA construct was used as a control. Synthetic oligonucleotides were annealed and cloned into pENTR/U6 (Invitrogen) and subsequently cloned into the pLL3.7GW vector as previously described [27] (link). The NIH 3T3 reporter cells were then infected with shRNA viruses.

The DNA sequences corresponding to the short hairpin RNA (shRNA) sequences of FABP1: 5′‐CACCGAACTCAATGGAGACACAATCCGAAGATTGTGTCTCCATTGAGTTC‐3′ and 5′‐AAAAGAACTCAATGGAGACACAATCTTCGGATTGTGTCTCCATTGAGTTC‐3′ were annealed and ligated into the shRNA expression vector pENTR/U6 (Life Technologies, Carlsbad, CA, USA). Recombinant adenoviruses were generated according to the manufacturer's instructions. As a negative control, a recombinant adenovirus expressing a shRNA of LacZ was also generated. Adenovirus was purified by CsCl gradient centrifugation. The virus titer was determined by TCID50. Animals were anesthetized with 2–3% isoflurane in air and 0.2 mg of polyinosinic acid was injected via the orbital plexus 5 min prior to adenovirus injection. Recombinant adenovirus vectors (Ad‐shFABP1 and Ad‐shLacZ) were injected intravenously in 100 μL of saline at a dose of 4 × 10⁸ pfu. After 1 week, mice were killed and both tissue and blood samples were collected for storage at −80 °C or fixed in 4% paraformaldehyde/PBS for histological analysis.

The shRNA constructs for the knockdown of human PLAC1 (NCBI Reference Sequence: NM_021796.3) were designed using the “BLOCK-iT™ RNAi Designer” online tool (Life Technologies, Darmstadt, Germany) [47 ]. Two different best ranked target sequences for shRNA (#59: 5′-ggttcaggacaaagtccaatg-3′; #60: 5′-GCTACGAGGTGTTCAGCTTGT-3′) were chosen and oligonucleotides were designed by following the instructions on the website. Forward and reverse oligonucleotides were annealed to generate double-stranded linkers with overhangs compatible with the commercially available precut BLOCK-iT™ entry vector (pENTR™/U6) (Life Technologies) and ligated into this vector. pENTR5′-CMV was cut using HindIII and BamHI restriction enzymes to excise the CMV promoter. The vector was blunted and re-circularized to generate an empty pENTR5′. To generate a green fluorescent protein (GFP)-tagged lentiviral gateway™ destination vector, the blasticidin resistance gene was removed from pLenti6.4-R4R2-V5-DEST and replaced by enhanced GFP (pLenti6.4-GFP-DEST). Empty pENTR5′, shRNA containing pENTR™/U6, and pLenti6.4-GFP-DEST were recombined using the LR-Clonase^® II Plus enzyme kit following the manufacturer’s instructions (Life Technologies) to get lentiviral shRNA vectors.