Abi 377 automated sequencer

RNAi was carried out to knock down A. aegypti mosquito genes. Each gene-specific forward and reverse oligonucleotide primer was designed using a NetPrimer web-based primer analysis tool. A T7 RNA polymerase promoter sequence, TAATACGACTCACTATAGGGAGA, was added to the 5′ end of each primer (S1 Table). All primers were purchased from Eurofins Genomics (Louisville, KY, USA). PCR was performed using the Taq 2X Master Mix (NEB, Ipswich, MA, USA) with mosquito whole-body complementary DNA (cDNA) as a template, and the amplified PCR products were cloned into the pGEM-T easy vector (Promega Madison, WI, USA) for DNA sequence verification using an ABI 377 automated sequencer (Applied Biosystems, Foster City, CA, USA). dsRNA was synthesized by in vitro transcription using a HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB). The purified dsRNA was resuspended with HPLC-grade water (Thermo Fisher Scientific, Waltham, MA, USA) at 7.3 μg/μL concentration. Cold-anesthetized female mosquitoes were injected with 2.0 μg dsRNA (276 nL) using a Nanoject II microinjector (Drummond Scientific Company, Broomall, PA). Injected mosquitoes were maintained on 10% sucrose throughout the experiments.

The obtained amplicons were purified using a QIAquick Spin PCR Purification kit (Qiagen, Hilden, Germany) and then sent for bidirectional sequencing with an ABI 377 automated sequencer (Applied Biosystems, Foster City, CA, USA) to GENEWIZ Services using the same PCR primers. The raw data were then sent to the laboratory for analysis. Chromatograms were analyzed using CodonCode Aligner 3.7.1 (Codon Code, Center Ville, MA, USA) with a Phred quality score cut off of 20 as the cut-off for low-quality sequence trimming.

The control region sequences were amplified using the primer pair of Ctrl Reg-L19 (5’-CCACTAGCTCCCAAAGCTA-3’) and Ctrl Reg-03-R (5’-GTGGGTAACGGGCAATAAGA-3’). PCR amplification was carried out in 45 µl using a reaction mix composed of 9 µl Taq polymerase buffer A (1×), 0.9 µl of dNTPs (0.2 mM), 1.35 µl of MgCl₂ (1.5 mM), 0.9 µl of each primer (0.2 µM), 0.18 µl of Taq DNA polymerase (0.02 U/µl) (Kapa Biosystems), 9.0 µl of template DNA (20 ng/µl), and 22.77 µl of DNAse-free and RNAse-free distilled water (Gibco). The thermal profile was performed as follows: initial denaturation at 94°C for 2 min followed by 25 cycles at 94°C for 45 s, 62°C for 45 s with −0.5°C per cycle and 72°C for 55 s, then 15 cycles at 94°C for 45 s, 54°C for 45 s, 72°C for 55 s and a final extension step at 72°C for 5 min. PCR products were visualized on 2% agarose gels, and prior to sequencing, these products were cleaned with a QIA-quick Gel Extraction Kit (Qiagen). PCR products were bi-directionally sequenced on an Applied Biosystems ABI377 automated sequencer. The sequences from forward and reverse reads were aligned and edited using GENEIOUS 4.0.2 software (Biomatters Ltd.) to obtain consensus sequences for all individuals. The sequences were deposited in GenBank under accession numbers MN166836–MN166903.

DNA extraction methods were presented in detail in a previous study (Wang et al., 2012 (link)). To optimize the cpSSR conditions, a total of 34 cp microsatellite loci were preliminarily screened. We chose eight polymorphic cp microsatellites (Table 1). Only cpSS 02 was an anonymous marker. It is unclear whether cpSS 02 is located in a coding or non-coding region of the cp genome. Polymerase chain reaction (PCR) was performed in a 20 μL final volume containing 1 × buffer, 25 Mm MgCl₂, 10 Mm each of dNTP, 0.5 U Taq polymerase, 5 mm of each primer, and 100 ng template DNA. The PCR program was as follows: an initial denaturation of 5 min at 94°C, followed by 35 cycles of denaturation at 94°C for 60 s, annealing at 55°C for 60 s, and elongation at 72°C for 120 s, and a final elongation of 72°C for 5 min. PCRs were conducted on a PTC-100 Peltier Thermal Cycler (MJ Research). The PCR products were sized on an ABI 377 automated sequencer (Applied Biosystems) using ROX-500 as the size marker.