Kapa taq readymix with dye

DNA was extracted from the overnight culture of all the isolates using bacterial genomic DNA Kit (Sigma Aldrich, St. Louis, MO, USA). All the thirty-four isolates were genotyped for virulence genes, such as genes involved in T3SS, exoS, exoT, exoU, exoY, pscL, pscU, elastase lasB, proteases like aprA, and prpL and a gene involved in biofilm formation, ladS. The PCR was performed using KAPA Taq ReadyMix with dye (KAPA Biosystems, Sigma Aldrich, St. Louis, MO, USA) using the following conditions for all except pscU and pscL denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s and extension at 72 °C for 30 s for 30 cycles. pscU and pscL were amplified as previously described [30 (link)]. Table 1 lists the sequences of the primer used for amplification of the genes. PAO1 that produces exoS, exoY and exoT and PA14 strain that expresses all the exotoxins were used as controls.

Paraffin-embedded cSCC from DMBA/TPA–treated mice were kindly gifted by the Laboratory of Prof. Sabine Werner. A few sections of tumors were collected in an Eppendorf tube together with 500 μl lysis buffer, which was incubated at 95°C for 10 min, and then centrifuged at 4°C, 20.817g for 5 min and the paraffin was removed. DNA extraction was performed as described above. Exome 23 of Alk was then amplified using KAPA Taq ReadyMix with dye (KK1024; Kapa Biosystems) with specific primers (msAlk-ex23_fw: CTATGCATCGCCCCAGGAAG, msAlk-ex23_Rv: GGCTGACTCCCAGGAGCCCA; MT = 60°C), and amplicons were sent for Sanger sequencing to Microsynth. Sequencing results were analyzed with Sequencer 5.1 (Genecode) and compared with reference sequence downloaded from Ensembl (www.ensembl.org).

For PCR amplification, 2 µL of the extracted DNA (approximately 10 ng) were used as template in a reaction volume of 10 µL, which also contained KAPA Taq ReadyMix with dye (Kapa Biosystems, Cape Town, South Africa) diluted with sterile nuclease-free water, at a final concentration of 1× (corresponding to a concentration of 0.2 µM dNTPs and 1.5 mM MgCl₂) and 0.2 µM of each of the primers to be used, viz.: ITS, RPB2, EF1-α [30 ,31 (link),32 (link)]. The ITS region was amplified using the primers ITS1: 5′-TCCGTAGGTGAACCTGCGG, and ITS4: 5′-TCCTCCGCTTATTGATATGC. The molecular marker EF1-α was amplified with the following primers EF1T: 5′-ATGGGTAAGGARGACAAGAC, and 1567R: 5′-ACHGTRCCRATACCACCSATCTT). RPB2 was amplified using fRPB2-5F: 5′-GAYGAYMGWGATCAYTTYGG and fRPB2-7cR: 5′-CCCATRGCTTGTYYRCCCAT. The amplification was performed in a Veriti 96 well Thermal Cycler (Applied Biosystems, Waltham, MA, USA) using the following program: 95 °C for 3 min; 35 cycles at 95 °C for 15 s, 54 °C for 15 s and 72 °C for 30 s; a final incubation step at 72 °C for 7 min. The PCR protocol used was the same for all three markers. PCR products were sequenced in one direction (forward) by automatic sequencing at Macrogen (ABI3730XL, Seoul, Korea).