Lentiviral vector gv358 mediated expression

Lentiviral vector GV248-mediated expression of control shRNA, two shRNA constructs targeting ANXA2 or GPC1, and lentiviral vector GV358-mediated expression of cDNAs of ANXA2 or GPC1 were obtained from Genechem Co., Ltd. (Shanghai, China), and cells were infected using the above lentiviruses with HitransG P (1×, Shanghai Genechem Co., Ltd.). After 48 h of transduction, the cells were collected and subjected to selection with 1 μg/mL puromycin for 5 days. The shRNA sequences targeting ANXA2 were as follows: sh1, CTGTACTATTATATCCAGCAA and sh2, CCTGCTTTCAACTGAATTGTT. The shRNA sequences targeting GPC1 were as follows: sh1, CTATTGCCGAAATGTGCTCAA and sh2, GACACTGTGCAGTGAGAAGAT. The following nontargeting shRNA sequence was used as the negative control: TTCTCCGAACGTGTCACGT.