ANRIL-overexpressing plasmids were constructed by inserting the ANRIL coding sequence into the pcDNA3.1 vector (Invitrogen; Thermo Fisher Scientific, Inc.). Oligonucleotides, including miR-181a mimic (5′-AACAUUCAACGCUGUCGGUGAGU-3′), negative control (NC) mimic (5′-UUCUCCGAACGUGUCACGUTT−3′), miR-181a antagomir (5′-ACUCACCGACAGCGUUGAAUGUU-3′) and NC antagomir (5′-CAGUACUUUUGUGUAGUACAA−3′), were purchased from Guangzhou RiboBio Co., Ltd. Small interfering (si)RNA targeting SIRT1 (siSIRT1, 5′-CCCUGUAAAGCUUUCAGAATT−3′) and NC siRNA (siNC; 5′-UUCUCCGAACGUGUCACGUTT−3′) were obtained from Shanghai GenePharma Co., Ltd. When the cell density reached 50–60% confluence, cell transfection was performed with Lipofectamine® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols. Equal amounts of empty pcDNA3.1 vector (4 µg/well), NC mimic, NC antagomir (50 or 150 nM) or siNC (10 or 20 nM) diluted in the same volume of transfection reagents were transfected as controls, depending on the experimental purposes. The efficiency was examined 2 days after transfection. For H/R treatment, cells were cultured under normoxia or exposed to H/R (hypoxia for 4 h followed by reoxygenation for 8 h) at 2 days after transfection. The transfection efficiency for all transfections was effective under normoxic or H/R treatment conditions.
Small interfering si rna
Manufactured by GenePharma
Sourced in China
Small interfering (si)RNA is a type of double-stranded RNA molecule that plays a role in the RNA interference (RNAi) pathway. Its core function is to silence gene expression by binding and degrading specific messenger RNA (mRNA) molecules, thereby preventing the production of the corresponding protein.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (4 mentions)
Puromycin, by Merck Group (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Si sirt1, by GenePharma (1 mentions)
Antagomir nc, by RiboBio (1 mentions)
Mir 181a mimic, by RiboBio (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
Pcdna3.1 vector, by Thermo Fisher Scientific (1 mentions)
Sirna1, by GenePharma (1 mentions)
Rnaimax, by Thermo Fisher Scientific (1 mentions)
β actin sc 47778 antibody, by Santa Cruz Biotechnology (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Puromycin, by Genechem (1 mentions)
Hitransg a, by Genechem (1 mentions)
6 protocols using small interfering si rna
1
ANRIL Overexpression and miR-181a Modulation
2
Lentivirus-Mediated SHCBP1 and RACGAP1 Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lentiviral vector containing SHCBP1 shRNA sequence (sh-1: CCAATTACAGTGAGTCTGATT; sh-2: GCTTGAGTGAAAGGTAGATTT), and non-effective scrambled shRNA (LV-Control, shNC) were constructed by GenePharma (Shanghai, China). Stable cells were established by transfection with these lentivirus vectors according to the manufacturer’s instructions. Antibiotic-resistant transfected cells were selected for 10 days with 1 μg/ml puromycin (Sigma, USA). Small interfering siRNA specific for RACGAP1 (siRNA-1: CTAGGACGACAAGGCAACTTT, siRNA-2: CAGGTGGATGTAGAGATCAAA) and negative control siRNA were purchased from GenePharma (Shanghai, China).
The expression vectors pCMV-Flag-RACGAP1, pCDNA3.1-HA-SHCBP1 (full length), pCDNA3.1-HA-SHCBP1 (1-428), pCDNA3.1-HA-SHCBP1 (1-548), pCDNA3.1-HA-SHCBP1 (428-672) were produced by TsingKe (Beijing, China). The mutant construct of SHCBP1 (S273A) was generated by site-directed mutagenesis and cloned into pCMV vector. Plasmids and siRNA were transfected with lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol.
The expression vectors pCMV-Flag-RACGAP1, pCDNA3.1-HA-SHCBP1 (full length), pCDNA3.1-HA-SHCBP1 (1-428), pCDNA3.1-HA-SHCBP1 (1-548), pCDNA3.1-HA-SHCBP1 (428-672) were produced by TsingKe (Beijing, China). The mutant construct of SHCBP1 (S273A) was generated by site-directed mutagenesis and cloned into pCMV vector. Plasmids and siRNA were transfected with lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol.
3
siRNA Knockdown of DDX21 and PTBP1 in PK-15 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DDX21 and PTBP1 genes were knocked down using commercially synthesized small interfering (si)RNA from GenePharma (Shanghai, China). The following duplex sequences were used in PK-15 cells: to target DDX21, 5′-CCCUUUGAUUGAGAAACUUTT-3′ and 5′-AAGUUUCUCAAUCAAAGGGTT-3′; to target PTBP1, 5′-GCUGGUCAGCAACCUCAAUTT-3′ and 5′-AUUGAGGUUGCUGACCAGCTT-3′. The following negative control (NC) siRNA sequences were used: 5′-UUCUCCGAACGUGUCACGUTT-3′ and 5′-ACGUGACACGUUCGGAGAATT-3′. Duplexes were delivered via RNAi Max (Invitrogen). Samples were collected 36 h post-transfection.
PK-15 cells were transfected with mammalian expression plasmids using Lipofectamine 2000 (Invitrogen) and incubated for 24 h at 37 °C. Samples were collected after 24 h and used for Western blot, qPCR, and dual-luciferase assays.
PK-15 cells were transfected with mammalian expression plasmids using Lipofectamine 2000 (Invitrogen) and incubated for 24 h at 37 °C. Samples were collected after 24 h and used for Western blot, qPCR, and dual-luciferase assays.
4
Mechanistic Insights into GSDME-mediated Pyroptosis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GSDME (ab215191), caspase-3 (ab13847), caspase-1 (ab179515), pro-IL-1β (ab2105) and mature (m)IL-1β (ab9722) antibodies were obtained from Abcam (Cambridge, UK); cleaved caspase-1 (3866), cleaved caspase-3(9661) antibodies were obtained from Cell Signaling Technology, Inc. (Danvers, MA, USA); β-actin (sc-47778) antibodies from Santa Cruz Biotechnology, Inc; anti-mouse IgG (H + L) HRP Conjugate (W402B) and anti-rabbit IgG (H + L) HRP (W401B) from Promega (Madison, WI, USA). All cell culture reagents were obtained from Thermo Fisher Scientific, Inc. TRIzol® reagent was obtained from Thermo Fisher Scientific, Inc. Lipofectamine® 3000 was purchased from Invitrogen (Thermo Fisher Scientific, Inc). Small interfering (si)RNA was purchased from Genepharma, Inc. Adeno-associated virus (AAV) 9-shGSDME virus purchased from HanBio Biotechnology Co. Ltd. (Shanghai, China). Short hairpin RNA (shRNA) sequences were designed by Hanbio Biotechnology to target rat GSDME.
5
Stable and Transient Transfection of IQGAP3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For stable transfection, lentiviral vector GV493 (hU6-MCS-CBh-gcGFP-IRES-puromycin) was packaged with IQGAP3 short hairpin (sh)RNA along with the respective negative control (NC), which were purchased from Shanghai GeneChem Co., Ltd. A total of 1×105 cells were plated into 6-well plates 24 h prior to stable transfection. Multiplicity of infection (MOI) was determined and the lentivirus was added to the culture medium complemented with the transfection reagent HiTransGA (Shanghai GeneChem Co., Ltd.) with a MOI value of 20–50. After 24 h incubation, the medium was replaced with fresh culture medium containing 2 µg/ml puromycin (Sigma-Aldrich; Merck KGaA) for selection of the stably transfected colonies.
Transient transfection was performed using small interfering (si)RNAs purchased from Shanghai GenePharma Co., Ltd. at a concentration of 20 µM. RNAi-mediated knockdown was performed with the following siRNAs: si-IQGAP3−1, 5′-GGCAGAAACUAGAAGCAUA-3′; si-IQGAP3−2, 5′-GAGCCAACCAGGACACUAA-3′; si-CDC42, 5′-GGACGGAUUGAUUCCACAU-3′; and si-NC, 5′-UUCUCCGAACGUGUCACGUTT-3′. Cells were transfected with Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The subsequent experiments were performed 24–48 h after transfection.
Transient transfection was performed using small interfering (si)RNAs purchased from Shanghai GenePharma Co., Ltd. at a concentration of 20 µM. RNAi-mediated knockdown was performed with the following siRNAs: si-IQGAP3−1, 5′-GGCAGAAACUAGAAGCAUA-3′; si-IQGAP3−2, 5′-GAGCCAACCAGGACACUAA-3′; si-CDC42, 5′-GGACGGAUUGAUUCCACAU-3′; and si-NC, 5′-UUCUCCGAACGUGUCACGUTT-3′. Cells were transfected with Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The subsequent experiments were performed 24–48 h after transfection.
6
Knockdown of ADAMTS9-AS1 using siRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small interfering siRNAs specifically targeting ADAMTS9-AS1 were synthesized by Shanghai Gene Pharma Co, Ltd. siRNA sequences for ADAMTS9-AS1: siRNA 1, 5′-GGAATTCAAGCTTCTACAA-3′; siRNA 2, 5′-CCACTGAACACATAAACAT-3′; siRNA 3, 5′-GGACTTGCAACTGTGACTT-3′; negative control: 5′-UUCUCCGAACGUGUCACGUTT-3′. siRNA plasmids were transfected into cells using Lipofectamine TM 2000 (Invitrogen, Carlsbad, CA, USA) and were incubated for 24 h according to the manufacturer’s instructions.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!