A203xvy nanoliter injector

The open reading frame of TgApiAT5-3 was amplified from RHΔhxgprt strain cDNA template using the primers 5’- GATCACCGGTCCACCATGGAGTCGACCGAGGCGACTAT and 5’- GATCCCTAGGCAGCACCTTCGGGACTTTTCTCTTC. The resultant product was digested with AgeI and AvrII, and ligated into the XmaI and AvrII sites of the vector pGHJ-HA [9 (link)]. The plasmid was linearised by incubation in NotI overnight, and complementary RNA (cRNA) encoding HA-tagged TgApiAT5-3 was prepared for injection into oocytes as previously described [54 (link)–56 (link)]. Xenopus laevis oocytes were surgically removed and prepared for cRNA injection as described [55 (link)]. For all transporter assays in oocytes, 15 ng of TgApiAT5-3 cRNA was micro-injected into stage 5 or 6 oocytes using a Micro4 micro-syringe pump controller and A203XVY nanoliter injector (World Precision Instruments).

Transporter and other gene constructs were all subcloned into the pGem-He-Juel (pGHJ) expression vector as previously described (Supplementary Table S1). Constructs were linearized using SalI or NotI restriction endonucleases (NEB, Ipswich, MA, United States) and mRNA was synthesized using in vitro transcription with either T7 or SP6 mMessage mMachine kits (Ambion, Austin, TX, United States). After purification using phenol-chloroform extraction and precipitation, cRNA was quantified using a Nanodrop spectrophotometer and adjusted to 1 mg/ml (Thermo Fisher Scientific, Scoresby, VIC, Australia) (OD₂₆₀/OD₂₈₀) (Broer, 2003 (link); Kowalczuk et al., 2008 (link)). Micro-injection of cRNA into oocytes was performed using a Micro4™ micro-syringe pump controller and A203XVY nanoliter injector (World Precision Instruments). The injection amount of all cRNAs was optimized previously or for this study (Broer et al., 2000 (link); Broer et al., 2001 (link); Bohmer et al., 2005 (link); Kowalczuk et al., 2008 (link); Fairweather et al., 2012 (link)). Oocytes were used 2–4 days post-injection unless otherwise indicated and as previously optimized for specific transporters. Oocytes were maintained in OR²⁺ (pH 7.8) buffer.