Qiashredder

Manufactured by Qiagen

Sourced in Germany, United States, United Kingdom, Canada, Netherlands, Spain, Switzerland, Japan, Australia

The QIAshredder is a laboratory equipment used for cell disruption and homogenization. It is designed to efficiently shear DNA, RNA, and protein samples to facilitate their extraction and purification.

Automatically generated - may contain errors

Lab products found in correlation

1 012 protocols using qiashredder

RNA Extraction from Skin Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from IBH-LE, IBH-NL and H control whole skin using RNeasy Fibrous Tissue Kit (Qiagen,). Prior to RNA extraction, skin samples were homogenized in 600 μL of RLT lysis buffer (Qiagen) using MagNa tissue lyser (Roche). Samples were homogenized for 45 s with ceramic beads (Roche, Basel, Switzerland) at the shaking speed of 6,500/min, followed by 2 min cooling on ice. Homogenization was repeated for another 30 s at shaking speed of 6,500/min and subsequent 2 min cooling on ice. Supernatants were loaded onto a spin column (QIAshredder, Qiagen) and centrifuged at 16,000x g for 2 min (Qiagen).
Total RNA was isolated from epidermis using RNeasy Mini Kit (Qiagen, Hilden Germany) according to the manufacturer's instructions. Prior to RNA extraction with RNeasy Mini Kit, cell lysates were loaded onto a spin column (QIAshredder, Qiagen) and centrifuged at 16000x g for 2 min.
Contaminating genomic DNA was removed by on-column DNase treatment in samples from epidermis and whole skin. Total RNA was quantified spectrophotometrically at 260 nm (NanoDrop 2000c; ThermoScientific, Reinach, Switzerland) and RNA samples were stored at -80⁰C until used. RNA quality was determined using Fragment Bioanalyzer (Labgene, Châtel-Saint-Denis, Switzerland).

Cvitas I., Oberhänsli S., Leeb T., Dettwiler M., Müller E., Bruggman R, & Marti E.I. (2020). Investigating the epithelial barrier and immune signatures in the pathogenesis of equine insect bite hypersensitivity. PLoS ONE, 15(4), e0232189.

+ Open protocol

+ Expand

RNA Isolation and qPCR Analysis of Mouse Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA isolated from lymphocytes was prepared using an RNeasy micro kit (Qiagen) with vortex and QIAshredder (Qiagen) disruption. RNA isolated from liver tissue was prepared using an RNeasy mini kit (Qiagen) using bead beat lysing (MP Biomedicals) and QIAshredder (Qiagen) disruption. cDNA was generated on 0.25 to 1.00 µg of RNA using a iScript cDNA synthesis kit (Bio-Rad). Real-time PCR was performed on 2.5 µl of cDNA product using iTaq Universal SYBR Green Supermix with ROX (Bio-Rad) and the following mouse gene primers: Gapdh, 5′-GGAGCGAGACCCCACTAACA-3′ (forward) and 5′-ACATACTCAGCACCGGCCTC-3′ (reverse); Il21, 5′-TCATCATTGACCTCGTGGCCC- 3′ (forward) and 5′-ATCGTACTTCTCCACTTGCAATCC- 3′ (reverse); and Ox40l, 5′-TCTGTGCTTCATCTATGTCTGC- 3′ (forward) and 5′-CATCCTCACATCTGGTAACTGC-3′ (reverse). Real-time PCR was performed on the 7300 Real-Time PCR System (Applied Biosystems).

Publicover J., Gaggar A., Jespersen J.M., Halac U., Johnson A.J., Goodsell A., Avanesyan L., Nishimura S.L., Holdorf M., Mansfield K.G., Judge J.B., Koshti A., Croft M., Wakil A.E., Rosenthal P., Pai E., Cooper S, & Baron J.L. (2018). An OX40/OX40L interaction directs successful immunity to hepatitis B virus. Science translational medicine, 10(433), eaah5766.

+ Open protocol

+ Expand

Theophylline-Mediated Regulation of C2C12 Myoblast Differentiation

Check if the same lab product or an alternative is used in the 5 most similar protocols

C2C12 cells were seeded in GM at 13,000 cells/well in 24-well plates. Twenty-four hours after seeding, cells were transfected using ViaFect Transfection Reagent (Promega) according to the manufacturer’s instructions using 1000 ng DNA/well and 8 μL of ViaFect per well. Four hours after transfection, media was replaced with fresh GM containing 0 mM or 1 mM theophylline. Forty-eight hours after transfection, when cells had reached 90–100% confluency, GM was replaced with fresh DM containing 0 mM or 1 mM theophylline. DM was replaced every 24 h until the indicated timepoint.
At the indicated timepoint, total RNA was extracted using the RNeasy Plus kit with QIAshredder (Qiagen) for homogenization following manufacturer’s instructions. RT-qPCR analysis was performed in triplicate using Luna Universal One-Step RT-qPCR Kit (New England BioLabs) and a QuantStudio 3 (Applied Biosystems). Thirty nanograms of total RNA was added to each 20 μL reaction in a 96-well plate. mRNA levels were normalized to beta-actin and plotted as the fold change from the expression level of the indicated switch control (generally sTRSVctrl or sTRSV).
The following primer sequences used for RT-qPCR were obtained from the Protein and Nucleic Acid Facility at Stanford University.
ACTB1:
HRAS:
JAK1:
MYOG:
MyHC (Myh 1):

Dykstra P.B., Rando T.A, & Smolke C.D. (2022). Modulating myoblast differentiation with RNA-based controllers. PLoS ONE, 17(9), e0275298.

+ Open protocol

+ Expand

Quantifying HIV-1 Gag RNA in Macrophages

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from HIV-1-infected MDM subsets and the presence of gag RNA was determined by qRT-PCR as previously described (21 (link), 25 (link)). Briefly, RNA was extracted from MDM using the RNeasy Mini Kit and Qiashredder (Qiagen) and the RNA was eluted in RNase free water. The qRT-PCR reactions were performed using the TaqMan RNA-to-Ct master mix (Applied Biosystems) and Viia7 (Applied Biosystems). Reactions (50 µl) were performed in the presence of the master mix, 0.2 µM each of Gag forward and reverse primers, Gag probe and 1× human GAPDH VIC-TAMRA (Applied Biosystems). Cycling parameters were 48°C for 20 min, 95°C for 10 min; then 45 cycles at 95°C for 15 s, and 59°C for 1 min. Delta Ct values were calculated to normalize the HIV-1 gag RNA signal as a function of the GAPDH/cellular RNA signal.

Jobe O., Kim J., Tycksen E., Onkar S., Michael N.L., Alving C.R, & Rao M. (2017). Human Primary Macrophages Derived In Vitro from Circulating Monocytes Comprise Adherent and Non-Adherent Subsets with Differential Expression of Siglec-1 and CD4 and Permissiveness to HIV-1 Infection. Frontiers in Immunology, 8, 1352.

+ Open protocol

+ Expand

Optimized RNA Extraction and qPCR Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For expression analyses of tissue samples, mice were killed by cervical dislocation. Samples were quickly cooled and region of interest prepared. RNA was extracted using RNeasy Mini (Qiagen). cDNA was synthesized with Superscript III (Invitrogen). Concentration and quality of RNA was evaluated using a NanoDrop spectrophotometer and RNA Nano (Agilent). RNA from MACS-purified cells was extracted using QIAshredder and RNeasy protocols (Qiagen). cDNA was amplified by Single Primer Isothermal Amplification (Ribo-SPIA® technology) using Ovation PicoSL WTA System V2 (NuGEN) following the manufactures protocol. Quantitative PCRs were done in triplicates on 384-well plates using the GoTaq® qPCR Master Mix (Promega, A6002) and the LightCycler® 480 Instrument. Background subtraction and thresholding was performed using the LightCycler® 480 software 1.5 (Roche)^{56 (link)}. Expression values were normalized to the mean of at least 2 out of the housekeeping genes Hprt, Rps13, Rplp0, Gapdh, 18S (Extended Data Fig. 2a, 5e, 9o, 10a). Quantification was done by applying the ΔΔCt method, normalized to experimental controls (set to 1). All primers (Supplementary Table 4) were designed to fulfill optimal criteria e.g. primer length (18-22 bp), melting temperature (52-58°C), GC content (40-60%), low number of repeats, amplicon length (<220 bp). All primers were intron-spanning.

Berghoff S.A., Spieth L., Sun T., Hosang L., Schlaphoff L., Depp C., Düking T., Winchenbach J., Neuber J., Ewers D., Scholz P., van der Meer F., Cantuti-Castelvetri L., Sasmita A.O., Meschkat M., Ruhwedel T., Möbius W., Sankowski R., Prinz M., Huitinga I., Sereda M.W., Odoardi F., Ischebeck T., Simons M., Stadelmann-Nessler C., Edgar J.M., Nave K.A, & Saher G. (2020). Microglia facilitate repair of demyelinated lesions via post-squalene sterol synthesis. Nature neuroscience, 24(1), 47-60.

+ Open protocol

+ Expand

RNA Extraction and cDNA Synthesis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted using commercially available RNeasy Plus Mini Kits (Qiagen) and QIAshredder (Qiagen) for liver and cortex or using the RNeasy Plus Micro Kits (Qiagen) for choroid plexus, as per manufacturers specifications. RNA quantity and purity was determined using a NanoDrop ND-1000 UV-VIS spectrophotometer (Thermo Scientific). cDNA conversion was conducted using the Applied Biosystems High Capacity RNA-cDNA Kits with each sample containing 20 μl (10 μl 2x reverse transcriptase buffer mix, 1 μl 20x RT enzyme mix and 9 μl combination of RNA and nuclease free water to standardize sample concentrations). Samples were incubated in a thermocycler (60 mins at 35 °C, 5 mins at 95 °C and 4 °C until removed) and cDNA stored at −20 °C until use.

Koehn L.M., Dziegielewska K.M., Møllgård K., Saudrais E., Strazielle N., Ghersi-Egea J.F., Saunders N.R, & Habgood M.D. (2019). Developmental differences in the expression of ABC transporters at rat brain barrier interfaces following chronic exposure to diallyl sulfide. Scientific Reports, 9, 5998.

+ Open protocol

+ Expand

Osteogenic Differentiation of HADMSC on Composite Scaffolds

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the HADMSC seeded on the two composite scaffold groups at day 14 by using QIA-Shredder and RNeasy mini-kits (QIAgen). Total RNA was synthesized into first strand cDNA by using an iScript cDNA synthesis kit (BioRad Laboratories). Real-time PCR analysis was performed in a StepOnePlus™ Real-Time PCR System (Thermo Scientific) using SsoAdvanced SYBR Green Supermix (Bio-Rad). The cDNA samples were analyzed for the genes of interest and for the housekeeping gene 18S rRNA. The level of expression of each target gene was calculated using the comparative Ct (2^−ΔΔCt) method. The primers used were summarized in Table 1.Table 1

Primer sequences for qPCR.

Table 1

Gene symbol	Genbank ID	Primer sequences (5′→3′)	Product size (bp)
18S	NR_003286	F: GAGAAACGGCTACCACATCC	170
18S	NR_003286	R: CACCAGACTTGCCCTCCA	170
ALP	NM_000478	F: CCACAAGCCCGTGACAGA	127
ALP	NM_000478	R: GGGCGGCAGACTTTGGTT	127
Runx2	NM_001024630	F: TACCTGAGCCAGATGACG	145
Runx2	NM_001024630	R: AAGGCCAGAGGCAGAAGT	145
OCN	NM_199173	F: GGCAGCGAGGTAGTGAAGA	148
OCN	NM_199173	R: CCTGAAAGCCGATGTGGT	148
OPN	NM_001040058	F: AAATTCTGGGAGGGCTTGG	117
OPN	NM_001040058	R: TTCCTTGGTCGGCGTTTG	117

Wei L., Wu S., Kuss M., Jiang X., Sun R., Reid P., Qin X, & Duan B. (2019). 3D printing of silk fibroin-based hybrid scaffold treated with platelet rich plasma for bone tissue engineering. Bioactive Materials, 4, 256-260.

+ Open protocol

+ Expand

RNA Extraction and Quantitative PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

786-0 cells were first treated and then infected as described. After 24 hours, the RNA from the lysed cells was homogenized with the QIAshredder (Qiagen, cat. 79656) and extracted with the QIAGEN Rneasy kit (Qiagen, cat. 74106) following the manufacturer’s protocol. The RNA was quantified using a NanoDropTM One Microvolume UV-Vis Spectrophotometer (Thermo Fisher Scientific, Rockford, IL). RevertAid First Strand cDNA Synthesis Kit was used to convert 1 ug of RNA to cDNA. The real-time PCRs were carried out on a 7500 Fast Real-Time PCR system (Applied Biosystems) using the Applied Biosystems PowerUp SYBR Green Master Mix (ThermoFisher Scientific) following the manufacturer’s protocol. The Pfaffl method was used to calculate gene expression.

Alwithenani A., Taha Z., Thomson M., Chen A., Wong B., Arulanandam R, & Diallo J.S. (2023). Unlocking the potential of dimethyl fumarate: enhancing oncolytic HSV-1 efficacy for wider cancer applications. Frontiers in Immunology, 14, 1332929.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cancer tissues using an RNAeasy mini kit in conjunction with a QIAshredder (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. The concentration and purity of the isolated RNA was confirmed using a NanoDrop Lite Spectrophotometer (Thermo Fisher Scientific). RNA was then reverse-transcribed using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. Target cDNA was amplified by PCR using QuantStudio3 with TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific), according to the manufacturer’s protocol. The primers were purchased from Integrated DNA Technologies (Coralville, IA, USA). Relative gene expression level was calculated using the comparative Ct method and expressed as fold changes relative to the control. HPRT and ACTB were used as internal control genes for human and mouse gene expression, respectively.

Murayama M., Hosonuma M., Kuramasu A., Kobayashi S., Sasaki A., Baba Y., Narikawa Y., Toyoda H., Isobe J., Funayama E., Tajima K., Sasaki A., Maruyama Y., Yamazaki Y., Shida M., Hamada K., Hirasawa Y., Tsurui T., Ariizumi H., Ishiguro T., Suzuki R., Ohkuma R., Kubota Y., Horiike A., Sambe T., Tsuji M., Wada S., Kobayashi S., Shimane T., Tsunoda T., Kobayashi H., Kiuchi Y, & Yoshimura K. (2024). Isobutyric acid enhances the anti-tumour effect of anti-PD-1 antibody. Scientific Reports, 14, 11325.

+ Open protocol

+ Expand

Quantitative PCR analysis of gene expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was harvested using the RNeasy Mini Kit and QIAshredder columns according to the manufacturer's instructions (Qiagen). cDNA was synthesized using SuperScript™ III First-Strand Synthesis SuperMix (Invitrogen). qPCR was performed using TaqMan Fast Universal PCR Master Mix without AmpErase UNG (Life Technologies) on the CFX96 Touch Real-Time PCR Detection System (Bio-Rad) with the following primers: CASP8 (Hs01018151_m1), FAT1 (Hs00170627_m1) and GAPDH (Hs02758991_g1) as the internal control (Life Technologies). Relative quantification was performed using the 1/ΔCt or ΔΔCt methods.

Hayes T.F., Benaich N., Goldie S.J., Sipilä K., Ames-Draycott A., Cai W., Yin G, & Watt F.M. (2016). Integrative genomic and functional analysis of human oral squamous cell carcinoma cell lines reveals synergistic effects of FAT1 and CASP8 inactivation. Cancer Letters, 383(1), 106-114.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!