Hygromycin

To generate OsMYB48-1 overexpression plants, the full-length coding region of OsMYB48-1 was amplified from the first-strand cDNA of Nipponbare using gene-specific primer pairs and cloned into the Asc I and Pac I sites of binary expression vector PMDC32 under the control of double Cauliflower Mosaic virus (CaMV) 35S promoter. The resultant construct was transformed into Agrobacterium tumefaciens EH105 and then transformed into Nipponbare by Agrobacterium-mediated transformation method [28] (link). The transgenic plants were selected in 1/2 MS medium containing 50 mg/L hygromycin (Roche, Germany).
To generate the RNA interference (RNAi) plants, the 462 bp cDNA sequence was amplified and cloned into the Kpn I and BamH I and then Spe I and Sac I sites of the pTCK303 vector as described previously [29] . Plant transformation protocols were taken as described above.

The ORF of LcMYB2 was ligated into pCAMBIA1302 to form the LcMYB2-GFP fusion protein. The recombinant plasmid was introduced into Agrobacterium tumefaciens EHA105 using a freeze-thaw method and further transformed into A. thaliana using the floral dip method [66 (link)]. Positive seedlings were selected on solid MS containing 50 μg/L hygromycin (Roche) and further confirmed by PCR. T3 seeds of the transgenic plants were germinated on MS, and the GFP fluorescence in the roots was observed under a laser confocal scanning microscope (Leica TCS SP5). To assess LcMYB2 transcription activity, the ORF was inserted downstream of GAL-BD in the pBridge vector to obtain pBD-LcMYB2. The recombinant vectors were introduced into the yeast strain AH109, and positive transformants were selected on SD (−Trp) medium and confirmed by PCR. β-galactosidase activity was assayed according to the Yeast Protocols Handbook (Clontech).

All oligonucleotides used to generate the deletion and complementation constructs are listed in Table 1. For cloning experiments, PCR reactions were performed using the Q5 high fidelity polymerase (New England Biolabs). To construct a suitable replacement cassette, a 3.5 kb hygromycin resistance cassette was excised from pSK346 using SfiI. 1000 bp upstream and downstream of the spa10 gene (Afu4g13320) were amplified by PCR from chromosomal DNA using the oligonucleotide pairs ∆spa10-5′-fwd/∆spa-5′-rev and ∆spa-3′-fwd/∆spa-3′-rev. After digestion with SfiI the PCR products were ligated to the hygromycin cassette. The resulting deletion construct was transformed into protoplast of A. fumigatus strain AfS35 and the cells were then transferred to AMM plates containing 1.2 M sorbitol and either 200 μg/ml hygromycin (Roche, Applied Science, Mannheim, Germany). To verify the mutant, we amplified spa10 using oligonucleotides spa10-fwd/spa10-rev (PCR1). The inserted hygromycin cassette was detected using the primer combinations ∆spa10-5′-cast/gpdA(p)-3-rev (PCR2) and hph-3-SmaI/∆spa10-3′-cast (PCR3). The complementation of the mutant with spa10 and spa10-rfp was verified using the primer combinations gpdA(p)-3-seq-fwd/Spa10-rev and gpdA(p)-3-seq-fwd/seq-mRFP1-rev.

BnABI3 cDNA was cloned from B. napus L. (cv. HuYou15). BnABI3 cDNA was sub-cloned into the pHB vector to generate 35S::BnABI3 transgenic lines (Supplementary Figure S1) (Mao et al., 2005 (link); Xu et al., 2016 (link)). To generate the proAtABI3::AtABI3 and proAtABI3::BnABI3 transgenic plants, 1.6 kb AtABI3 promoter was fused with the AtABI3 and BnABI3 CDS sequences and sub-cloned into the pCAMBIA1300 vector. Transgenic gs1 mutant expressing proAtABI3::BnABI3 chimeric gene was obtained by hybridization. To generate 4Enhp BnABI3-BnABI3GR, the CaMV 35S enhancer tetrad was amplified using pSKI015 as template and cloned into pQDL4R1 to generate pQDL4R1-4Enh. The GR domain was cloned from pTA7002 and the coding region of BnABI3 was cloned from cDNA. Both fragments were fused together and cloned into pQDR2L3 vector to generate pQDR2L3-BnABI3GR. All the reagents and digest enzymes used for PCR amplification and molecular clone were ordered from Takara, Japan. The constructs were transformed into Agrobacterium tumefaciens GV3101 and transformed into Col-0 Arabidopsis by using the floral-dip method (Clough and Bent, 1998 (link)). The positive transgenic plants were screened by 50 mg/L Hygromycin (Roche, United States). Real time PCR were performed to detect the gene expression levels in transgenic plants, and the primers used are shown in Supplementary Table S1.

The following expression plasmids were used in this study: pYNC989 (vFLIP-myc), pNF-kB-Luc (Stratagene), pGL4.70[hRluc] (Promega) and pcDNA3.1. pCMV-myc-RAUL-WT and the pCMV-myc-RAUL dominant negative mutant (C1051A) were provided by Cecile Pickart [17] (link). pSEW R01 (WT RTA), pSEW R03, pSEW R04, pSEW R06, pSEW R11 and RTA H145L have been described previously [13] (link), [18] (link). V5 tagged RTA 11–149 was cloned into pcDNA3.1 using the following primers: F- 5′-ATCGGAATTCGTTATGGTTCGGCGGTCCTGTGTGGAAAG and R-5′-TATATCTAGATTTTCACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAG GCTTACCCAGGCATTTGGCCTTCATTTCAG. The following reagents were used in this study: MG132 (Boston Biochem), doxycycline (Sigma), hygromycin (Roche), and antibodies anti-cmyc (Millipore), anti-tubulin (Sigma), anti-β-actin (Sigma), rabbit anti-RTA and rabbit anti-RAUL (24, 25).)

M. smegmatis cultures were grown in Middlebrook 7H9 medium (Becton Dickinson, Sparks, MD) supplemented with ADS enrichment (Albumin-Dextrose Saline containing 5% (w/v) Bovine serum albumin fraction V, 2% (w/v) D-Dextrose and 8.1% (w/v) NaCl) (Jacobs et al., 1991 (link)), 0.05% (v/v) Tween 80, and 0.5% (v/v) glycerol (Beijing Modern Eastern Finechemical Co. Ltd, Beijing). Middlebrook 7H10 medium supplemented with ADS enrichment and 0.5% (v/v) glycerol was used as the solid medium for examination of growth status. Growth was also examined in minimal Sauton's medium (4 g asparagine, 2 g sodium citrate, 0.5 g K₂HPO₄·3H₂O, 0.5 g MgSO₄·7H₂O, 0.05 g ferric ammonium citrate, 60 g glycerol in 1 L of H₂O supplemented with 0.05% (v/v) Tween 80) supplemented with antibiotics as indicated. Hygromycin (75 mg/L for M. smegmatis, 150 mg/L for Escherichia coli; Roche) and kanamycin (25 mg/L for M. smegmatis, 50 mg/L for Escherichia coli; Amresco) were added to the medium as needed. All bacterial strains used in this study are listed in Table S1.