Rna easy isolation reagent

The total RNA of BV-2 cells was harvested using RNA-easy^TM Isolation Reagent (Vazyme Biotech, China), and reverse transcription reaction was conducted with FastKing-RT SuperMix (TIANGEN Biotech, China). Reactions were performed according to the manufacturer’s protocol. cDNA was subjected to quantitative real-time polymerase chain reaction (qRT-PCR) assays with specific primers and TransStart TOP Green qPCR SuperMix (TransGen Biotech, China). The primers are listed in Supplementary Table 1 and β-actin was used as the internal control. The 2^–ΔΔCT method was used for quantitative analysis.

Total RNA was isolated from cell lysates utilizing the RNA-easyTM isolation reagent (Nanjing Vazyme BioTech CO., Ltd, R711-01). Complementary DNA was then synthesized from the extracted RNA using the HiscriptII Q RT Supermix for qPCR (Vazyme, R223-01). The mRNA expressions of target genes were quantified using a SYBR green PCR master mix (abm, G891-1). The PCR amplification was carried out on a QuantaStudio5 real‐time PCR system (Applied biosystems by Thermo Fisher Scientific). Each PCR experiment was conducted in triplicate. The relative mRNA levels of target genes were calculated using the 2^−ΔΔCt method, with β-ACTIN as the internal control.
Primer sequences were as follows:
KDM4C-F: 5′-CATGGAGTCTAAAGGAGCCCA-3′;
KDM4C-R: 5′-TGTACTGAGTGAACAGTCCTGA-3′;
MDR1-F: 5′-CCCATCATTGCAATAGCAGG-3′;
MDR1-R: 5′-GTTCAAACTTCTGCTCCTGA-3′;
β-ACTIN-F: 5′-CTGGAACGGTGAAGGTGACA-3′;
β-ACTIN-R: 5′-AAGGGACTTCCTGTAACAACGCA-3′.

Total RNA was extracted from approximately 1000 worms. The worms were starved again with the trained odorant for 2 h and then washed thrice in M9 and once in DEPC‐treated water. Total RNA was isolated from WT animals using RNA‐easy TM Isolation Reagent (Vazyme, China). Gene expression levels were normalized to Act‐1 expression levels. RT‐PCR was carried out using random primers, the HiScriptⓇ II One Step qRT‐PCR SYBRⓇ Green Kit (Vazyme, China), and a real‐time PCR machine (Applied Biosystems QuantStudio Flex System). The primers for the genes were synthesized by Sangon Biotech (Shanghai, China), as follows: 5′‐TTCCAGTGATGGCTGACG‐3′ and 5′‐GGCTTCTAGGCCTACTTCG‐3′ for hsp‐12.6; 5′‐AGTGTGACTGCAAAAACAAGCAA‐3′ (forward) and 5′‐TCCACTGCATTCACATTTGTCTC‐3′ (reverse) mtl‐1; 5′‐CTGCGTAAACCTTCAAACTC‐3′ and5′‐ATGCGGAGTTACCATAGTTC‐3′ for cpr‐2; 5′‐CTAAGGATGGTGGAGAACCTTCA‐3′ and 5′‐CGCGCTTAATAGTGTCCATCAG‐3′ for sod‐3;and 5′‐ACCACGCTCGTATGCTGAAA‐3′ and 5′‐GTTTTCCTCCGCGTGGATTG‐3′ for rgs‐3; 5′‐GAGCACGGTATCGTCACCAA‐3′ (forward) and 5′‐TGTGATGCCAGATCTTCTCCAT‐3′ (reverse) for act‐1. act‐1 was used to normalize mRNA expression. The relative quantification of the gene expression was calculated by the 2^−ΔΔCT method.

Genomic DNA and RNA were extracted using FastPureTM Plant DNA Isolation Mini Kit (Vazyme, Nanjing, China) and RNA-easyTM Isolation Reagent (Vazyme, Nanjing, China), respectively. DNA and RNA quantification and qualification were performed using 1% agarose gel electrophoresis, a Qubit 2.0 fluorometer (Thermo Fisher Scientific, USA), and a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). Nanopore libraries were prepared using SQK-LSK108 and sequenced on a Nanopore PromethION sequencer. DNA libraries for short-read whole genome sequencing (WGS) were constructed using the Illumina TruSeq DNA PCR-free library preparation kit (Illumina, CA, USA) with 300- to 500-bp fragment sizes, and sequenced on the Illumina NovaSeq 6000 platform to generate 150-bp paired-end (PE) reads. Transcriptome libraries were constructed with a TruSeq RNA Library Prep Kit v2 (Illumina, CA, USA) with an insert size of 200–400 bp, after polyA selection, and sequenced on an Illumina NovaSeq 6000 platform, and 150-bp PE reads were generated. The Hi-C library construction process includes cross-linking, restricted enzyme digestion (MboI), end repair, DNA cyclization, and purification (Yu et al., 2022 (link)). PE-150-bp reads were generated on Illumina NovaSeq 6000 platforms.

Total RNA was extracted from the cervical cancer cells and normal cervical cells with RNA-easy^TM Isolation Reagent (Vazyme, #R701, Nanjing, China), and the quantitative cDNA was synthesized via reverse transcription and used for qRT-PCR. The human PRAME primer was listed as follows: forward, 5′-CGTGCCTGAGCAACTGAT-3′; reverse, 5′-TACCCACCTTGGCGAAAT-3′. The expression of PRAME mRNA was normalized to β-actin expression according to the 2^−ΔΔCt formula. The PRAME mRNA expression in Ect1/E6E7 cells was defined as 1 for comparison.

Following the manufacturer’s instructions, we extracted RNA from purified sperm samples using RNA-easyTM Isolation Reagent (Vazyme, Nanjing, China) and synthesize cDNA using the Hifair^® II 1st Strand cDNA Synthesis Kit (Yeasen, Shanghai, China). Herein, we diluted the cDNA to the proper concentrations, and performed quantitative real-time polymerase chain reaction (qRT-PCR) as previously described (26 (link)). Expression levels of hub CORGs were calculated after normalization of the reference gene GAPDH. The detailed information on primers used in the study is shown in Supplementary Table 1.