Ab236639

Manufactured by Abcam

Sourced in United Kingdom, United States, China

Ab236639 is a lab equipment product. It is a device used for laboratory analysis and experimentation.

Automatically generated - may contain errors

Lab products found in correlation

Ab209484, by Abcam (13 mentions) Ab133612, by Abcam (10 mentions) Ab8245, by Abcam (10 mentions) Ab93876, by Abcam (8 mentions) Ab229126, by Abcam (8 mentions) Ab6721, by Abcam (6 mentions) Bca protein assay kit, by Beyotime (6 mentions) Ab9485, by Abcam (5 mentions) Ab214821, by Abcam (4 mentions) Ab8227, by Abcam (4 mentions) Ab32572, by Abcam (4 mentions) Ab214050, by Abcam (4 mentions) Pvdf membrane, by Merck Group (4 mentions) Ripa buffer, by Thermo Fisher Scientific (4 mentions) Bca protein assay kit, by Thermo Fisher Scientific (4 mentions) Ab7090, by Abcam (3 mentions) Ab6789, by Abcam (3 mentions) Ab185966, by Abcam (3 mentions) Ab270993, by Abcam (3 mentions) Ab260043, by Abcam (3 mentions)

58 protocols using ab236639

Immunoprecipitation of Autophagy Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were lysed in Lysis buffer (Cell Signaling Technology) supplemented with Halt™ Protease Inhibitor Cocktail (Thermo Fisher Scientific) and total protein concentration determined (Thermo Fisher Scientific). Cell lysates (500 μg) were incubated for 12 h at 4°C either with 5 µg/ml anti-Runx2 (ab236639; Abcam), 5 µg/ml anti-p62 (ab240635; Abcam), or 5 µg/ml anti-LC3 (PM036; MBL international) or 5 µg/ml anti-rabbit IgG (7074; Cell Signaling Technology).
Subsequently the lysates were incubated with 20 µl Protein G magnetic agarose beads (73778; Cell Signaling Technology) for 30 min at room temperature. Protein bound to the beads was washed five times with Lysis buffer, pelleted using a magnetic rack and boiled for 8 min in NuPAGE LDS sample buffer with NuPAGE sample reducing agent (Thermo Fisher Scientific) before analysis by immunoblotting with Runx2 (ab236639; Abcam), p62 (ab240635; Abcam), and LC3 (PM036; MBL international) antibodies as described above.

Phadwal K., Koo E., Jones R.A., Forsythe R.O., Tang K., Tang Q., Corcoran B.M., Caporali A, & MacRae V.E. (2022). Metformin protects against vascular calcification through the selective degradation of Runx2 by the p62 autophagy receptor. Journal of cellular physiology, 237(11).

+ Open protocol

+ Expand

Western Blot Analysis of Osteogenic Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total protein of cells was extracted using radioimmunoprecipitation assay lysis buffer (Beyotime, Nanjing, Jiangsu, China). The protein concentration was assessed using the bicinchoninic acid (BCA) protein assay kit (Beyotime). The samples were loaded for electrophoresis. Then, the protein was transferred to the polyvinylidene fluoride (PVDF) membranes using the wet method, electric transferred in a cold chamber at a voltage of 70 V at 4 °C for 2 h, and the PVDF membranes were removed and blocked with 5% skim milk-Tris buffered saline-Tween20 (TBST), and incubated at room temperature for 1 h. After blocking, the membranes were placed into the incubation box and cultured with rabbit anti-mouse primary antibodies anti-APT1 (1:1000, 25 kDa, ab91606, Abcam), anti-OCN (1:500, 11 kDa, ab93876, Abcam), anti-RUNX2 (1:1000, 57 kDa, ab236639, Abcam), anti-Osterix (1:1000, 47 kDa, ab209484, Abcam), anti-BMPR1a (1:1000, 60 kDa, ab264043, Abcam), BMP (1:1000, 44 kDa, ab214821, Abcam), p-Smad (1:1000, 52 kDa, ab92698, Abcam) at 4 °C overnight. Subsequently, the samples were eluted with TBST and incubated with secondary antibody goat anti-rabbit IgG (1:20000, ab6721, Abcam) at room temperature for 1 h. With GADPH (1:5000, 37 kDa, ab9485, Abcam) as the internal parameter, chemiluminescence method was employed for detection and gray analysis.

Ji C., Dong Q., Liu H., Yang X., Han Y., Zhu B, & Xing H. (2023). Acyl-protein thioesterase1 alleviates senile osteoporosis by promoting osteoblast differentiation via depalmitoylation of BMPR1a. Regenerative Therapy, 24, 351-360.

+ Open protocol

+ Expand

Osteogenesis Protein Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For osteogenesis relative protein, antibody BMP2 (1:1000; abcam, ab284387), RUNX2 (1:1000; abcam, ab236639), ALP (1:1000; abcam, ab203106) and OPN (1:1000; abcam, ab63856) were chosen. Osteogenesis signal pathway test was used PI3K/Akt (1:1000; abcam, ab283852) and p38/MAPK14 (1:1000; abcam, ab170099) antibody. Protein extraction and Western blot were carried out as previously described. The membrane was then washed and blocked with 5% skimmed milk and probed overnight. The bound primary antibody was detected by peroxidase-conjugated goat anti-mouse IgG (Sigma-Aldrich) and the ECL Western blot analysis system (Millipore). Each experiment was performed at least three times. Statistical significance was set at 5%.

Li X., Liu Z., Xu S., Ma X., Zhao Z., Hu H., Deng J., Peng C., Wang Y, & Ma S. (2022). A drug delivery system constructed by a fusion peptide capturing exosomes targets to titanium implants accurately resulting the enhancement of osseointegration peri-implant. Biomaterials Research, 26, 89.

+ Open protocol

+ Expand

Osteogenic Differentiation Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

After 21 days of osteogenic differentiation of DPSCs, PDLSCs, DFPCs, and ABMMSCs, the total cellular protein was extracted using the RIPA lysis buffer (Sigma, USA), and concentrations were measured by Bradford protein assay kit (Sangon Biotech, China). MSCs that were cultured in MEM-α medium containing 10% FBS were used as a control. The samples were heated for 8 min at 100°C. Equal amount of proteins was separated by 10% SDS-polyacrylamide gel and transferred to polyvinylidene difluoride (PVDF) membranes (Bio-Rad, USA). The membranes were blocked with 5% skim milk for 2 hours at room temperature and then incubated with primary antibodies RUNX2 (1 : 2000, ab236639, Abcam), ALP (1 : 2000, ab83259, Abcam), OSX (1 : 2000, ab94744, Abcam), OPN (1 : 2000, ab8448, Abcam), and β-actin (1 : 2000, ab8227, Abcam) overnight at 4°C. After washing with TBST buffer, the blots were incubated with HRP goat anti-rabbit (1 : 1000, Abcam) for 1 hour at room temperature. The proteins were visualized using a ChemiDoc imaging system (Bio-Rad, USA).

Qu G., Li Y., Chen L., Chen Q., Zou D., Yang C, & Zhou Q. (2021). Comparison of Osteogenic Differentiation Potential of Human Dental-Derived Stem Cells Isolated from Dental Pulp, Periodontal Ligament, Dental Follicle, and Alveolar Bone. Stem Cells International, 2021, 6631905.

+ Open protocol

+ Expand

Evaluating Inflammatory and Osteogenic Markers in BMSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

In order to assess the gene expression of inflammatory cytokines and osteogenic-related factors, qRT-PCR was applied as we described before [32 (link)]. The primers are listed in Table 1.Table 1

Primers used for qRT-PCR.

Table 1

Gene	Forward Primer	Reverse Primer
GADPH	AGGTCGGTGTGTGAACGGATTTG	TGTAGACCATGTAGTTGAGGTCA
IL-1β	TGGAGAGTGTGGATCCCAAG	GGTGCTGATGTACCAGTTGG
TNF-α	CTGAACTTCGGGGTGATCGG	GGCTTGTCACTCGAATTTTGAGA
ALP	CCAACTCTTTTGTGCCAGAGA	GGCTACATTGGTGTTGAGCTTTT
OPN	CAGGGAGGCAGTGACTCTTC	AGTGTGGAAAGTGTGGCGTT
Runx 2	TTCAACGATCTGAGATTTGTGGG	GGATGAGGAATGCGCCCTA

To explore the osteogenic differentiation of BMSCs under inflammatory conditions, the protein expression of Col I, Runx2, OCN and OPN was determined by western blot analysis as we previously described [32 (link)]. Anti-Col I (ab21286, Abcam, UK), anti-Runx2 (ab236639, Abcam, UK), anti-OPN (ab283656, Abcam, UK) and anti-OCN (ab93876, Abcam, UK) primary antibodies were used in this study.

He Z., Liu S., Li Z., Xu J., Liu Y, & Luo E. (2022). Coaxial TP/APR electrospun nanofibers for programmed controlling inflammation and promoting bone regeneration in periodontitis-related alveolar bone defect models. Materials Today Bio, 16, 100438.

+ Open protocol

+ Expand

Quantitative Protein Analysis of Osteogenic Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total proteins were extracted using RIPA reagent (Beyotime Biotechnology, Shanghai, China) and the protein concertation was determined by BCA kit (Beyotime Biotechnology, Shanghai, China) as per the instructions. Then, 25 μg of protein was loaded on 10% SDS-PAGE and transferred on PVDF membranes (Millipore, Billerica, MA). After blocking with 5% skimmed milk for 1 h, PVDF membranes were incubated with primary antibodies (rabbit anti-RUNX2, 1:1000, ab236639; rabbit anti-OCN, 1:1000, ab133612; rabbit anti-OSX, 1:1000, ab209484; rabbit anti-OPN, 1:1000, ab8448; rabbit anti-GAPDH, 1:1000, ab9485; all purchased from Abcam, Shanghai, China) overnight at 4°C. The following day, membranes were washed 3 times with TBST buffer for 5 minutes each, and further incubated with secondary antibody (goat anti-rabbit H&L preadsorbed, 1:1000, ab7090; purchased from Abcam, Shanghai, China) for 2 h at room temperature. The protein bands were visualized using an enhanced chemiluminescence kit (Yeasen, Shanghai, China) and photographed on a gel imager system (Bio-Rad, Hercules, CA, United States). GAPDH functioned as the internal control.

Ding R., Wei S, & Huang M. (2022). Long non-coding RNA KCNQ1OT1 overexpression promotes osteogenic differentiation of staphylococcus aureus-infected human bone mesenchymal stem cells by sponging microRNA miR-29b-3p. Bioengineered, 13(3), 5855-5867.

+ Open protocol

+ Expand

Protein Expression Analysis of C2C12 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

C2C12 cells were lysed with an ice-cold radio immunoprecipitation assay lysis buffer containing protease and phosphatase inhibitor cocktails (Abcam, Cambridge, UK). Protein lysates were cleared by centrifugation at 4 °C for 15 min, and the supernatants were collected for further experiments. 30 μg total protein samples (each lane) mixed with loading buffer (Beyotime) were subjected to sodium dodecyl sulphate-polyacrylamide gel electrophoresis and then transferred to polyvinylidene fluoride membrane (Millipore, Burlington, MA, USA). Primary antibodies used to detect specific proteins were: MT1/2 (Abcam, ab95042; 1:1000 dilution), MT3 (Santa Cruz Biotechnology, Santa Cruz, CA, USA, sc-164990; 1:500 dilution), ALP (Abcam, ab229126; 1:1000 dilution), Runx2 (Abcam, ab236639; 1:1000 dilution), Osterix (Abcam, ab229258; 1:2000 dilution), Dlx5 (Abcam, ab109737; 1:3000 dilution), p-Smad1/5 (Cell Signaling Technology, Danvers, MA, USA, 9516; 1:1000 dilution), and GAPDH (Abcam, ab8245, 1:5000 dilution). After incubation with appropriate secondary antibodies, protein bands were visualized by using electrochemiluminescence reagent (Millipore), and images were captured by Amersham Image 600 system (GE Healthcare Life Sciences, Marlborough, MA, USA).

Li S., Kim M.J., Lee S.H., Jin L., Cong W., Jeong H.G, & Lee K.Y. (2021). Metallothionein 3 Promotes Osteoblast Differentiation in C2C12 Cells via Reduction of Oxidative Stress. International Journal of Molecular Sciences, 22(9), 4312.

+ Open protocol

+ Expand

Protein Expression Analysis in Osteoblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols

The extracts of total protein were prepared by lysing MC3T3-E1 cells in a RIPA buffer containing protease inhibitors. BCA assays were employed to determine the concentrations of protein. 30 μg proteins of each sample were added to 10% SDS-PAGE and then electrotransferred to the PVDF for further immunoblotting. Antibodies were used: anti-Runx2 (1:1000, ab236639, Abcam), anti-Osx (1:1000, ab209484, Abcam), anti-p53 (1:1000, 60283-2-Ig, Proteintech), anti-CyclinD1 (1:1000, 26939-1-AP, Proteintech), anti-Bcl-2 (1:1000, 26593-1-AP, Proteintech), anti-Bax (1:1000, 60267-1-Ig, Proteintech), anti-p38 (1:1000, #8690, Cell Signal Technology), anti-p-p38 (1:1000, #4511, Cell Signal Technology), anti-JNK (1:1000, #9255, Cell Signal Technology) anti-p-JNK (1:1000, #9255, Cell Signal Technology), and anti-β-actin antibody (1:1000, AF0003, Beyotime). PVDF were incubated with diluted antibodies. Goat anti-rabbit IgG H&L (HRP) (1:5000, ab6721, Abcam) or goat anti-mouse IgG H&L (HRP) (1:5000,ab6789, Abcam) was used to co-incubate with PVDF at 37°C for 1 h. Proteins were detected by ECL, and quantitatively analyzed by scanning densitometry (Bio-Rad, United States).

Xie B., Zeng Z., Liao S., Zhou C., Wu L, & Xu D. (2021). Kaempferol Ameliorates the Inhibitory Activity of Dexamethasone in the Osteogenesis of MC3T3-E1 Cells by JNK and p38-MAPK Pathways. Frontiers in Pharmacology, 12, 739326.

+ Open protocol

+ Expand

Immunohistochemical Analysis of Femoral Heads

Check if the same lab product or an alternative is used in the 5 most similar protocols

The processes of fixation, decalcification, embedding, and sectioning of the femoral heads were the same as those described for H&E staining. For immunohistochemical staining, the slices were subjected to deparaffinization; antigen retrieval; blocking in horse serum for 30 min; incubation with primary antibodies against Osterix (dilution 1: 100, Abcam: #ab209484), runt-related transcription factor 2 (RUNX2) (dilution 1: 100, Abcam: #ab236639), and osteocalcin (OCN) (dilution 1: 100, Abcam: #ab93876) for 12 h; and then incubation with the appropriate biotinylated secondary antibodies. All antibodies were purchased from Abcam (Cambridge, UK). Finally, the slices were stained with diaminobenzidine and counterstained using hematoxylin. Section images were acquired using an Axiovert 5 × and 20 × optical microscope (Zeiss, Germany), and the number of positive cells was used as a quantitative indicator.

Li W., Li W., Zhang W., Wang H., Yu L., Yang P., Qin Y., Gan M., Yang X., Huang L., Hao Y, & Geng D. (2023). Exogenous melatonin ameliorates steroid-induced osteonecrosis of the femoral head by modulating ferroptosis through GDF15-mediated signaling. Stem Cell Research & Therapy, 14, 171.

+ Open protocol

+ Expand

Cell Differentiation and Stimulation Assay Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cell culture reagents, including fetal bovine serum (FBS; 10099141C), minimum essential medium α (α-MEM; C12571500BT), and penicillin/streptomycin (P/S; 15140122), were all purchased from Gibco (USA). Reagents for cell differentiation and stimulation included lipopolysaccharide (L8274; Sigma-Aldrich), cyclic polypeptide D7 (Scilight-Peptide Inc.), ascorbic acid (A8960; Sigma-Aldrich), β-glycerophosphate disodium (G9422; Sigma-Aldrich), dexamethasone (HY-14648; MCE), macrophage colony-stimulating factor (M-CSF; 416-ML-050; R&D Systems), and receptor activator of nuclear factor-κB ligand (RANKL; 462-TEC-010; R&D Systems). Primary antibodies that used in western blotting (WB) for the detection of ALP (ab229126), Runx2 (ab236639), and Ctsk (ab187647) were from Abcam; for Col1α1 (72026t) detection was from Cell Signaling Technology; for Nfatc1 (sc-7294) and Traf6 (sc-8409) detections were from Santa Cruz; for β-actin (hrp-66009) detection was from Proteintech. Secondary antibodies were purchased from Proteintech, including anti-rabbit (SA00001-2) and anti-mouse (SA00001-1).

Cui Z., Feng C., Chen J., Wang Y., Meng Q., Zhao S., Zhang Y., Feng D., Li Z, & Sun S. (2022). Network Pharmacology Deciphers the Action of Bioactive Polypeptide in Attenuating Inflammatory Osteolysis via the Suppression of Oxidative Stress and Restoration of Bone Remodeling Balance. Oxidative Medicine and Cellular Longevity, 2022, 4913534.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!