Nci h460

Human cancer cell types that originated from ovary (SK-OV3), prostate (22Rv1 and PC3), cervix (HeLa), breast (MDA-MB-231), liver (SK-HEP-1), brain (A172), kidney (ACHN), and lung (NCI-H460) were purchased from the Korean Cell Line Bank. Cells were cultured in DMEM or RPMI (GIBCO) medium containing 10% FBS (GIBCO) and 1% penicillin/streptomycin (GIBCO) at 37°C in a 10% CO₂ humidified atmosphere.

Human lung adenocarcinoma NCI-H460 and A549 cells were purchased from the Korean Cell Line Bank (KCLB, Seoul, Korea) and were authenticated before being frozen by KCLB using STR. NCI-H460 cells were cultured at 37 °C in a 5% CO₂ humidified atmosphere in RPMI-1640 medium supplemented with 10% (v/v) heat-inactivated fetal bovine serum, 100 units/mL penicillin, and 100 µg/mL streptomycin. NCI-H460 and A549 cells were exposed to stepwise escalating levels of paclitaxel to produce paclitaxel-resistant cells. The concentration of paclitaxel increased 2-fold at each step of resistance from 1 nM up to 20 nM for NCI-H460^TXR. The resistant cells were established after NCI-H460^TXR exposure of 30 weeks to paclitaxel. A549^TXR cells were developed by exposing A549 cells (Prof. Sang Kook Lee, Seoul National University, Seoul, Korea) to up to 200 nM paclitaxel over 12 months. In the NCI-H460^TXR cells, various versions of PLK1 mutants were expressed for additional weeks using lentiviral pLVX-TRE3G-eRFP-PLK1 and pLVX-Tet3G vectors (Clontech #631351; Palo Alto, CA, USA) in an expression system as described previously [22 (link)]. For lentiviral PLK1 shRNA, the targeting sequences of human PLK1 (gene access no. NM_005030) are AGATTGTGCCTAAGTCTCTGC at positions 245–265 (#1) and AGATCACCCTCCTTAAATATT at positions 1424–1444 (#2) as described previously [22 (link),23 (link)].

Human NSCLC cell lines (A549, NCI-H460 and NCI-H1703) were purchased from the Korean Cell Line Bank (KCLB, Seoul, Korea) and maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) and antibiotic-antimycotic solution (Life Technologies, Seoul, Korea). Human hepatocellular carcinoma cell line Huh7 was also purchased from the KCLB. Human bronchial epithelial cell line BEAS-2B was purchased from the American Type Culture Collection (ATCC, Manassas, VA) and maintained in DMEM medium supplemented with 10% FBS and antibiotic-antimycotic solution (Life Technologies). H9 hESCs were cultured on mouse embryonic fibroblast (MEF) feeder cells as described previously [6 (link), 14 (link)]. Human PBMCs were isolated by the Ficoll-Paque Plus method (GE Healthcare, Seoul, Korea). FO myeloma cells were maintained in DMEM medium supplemented with 10% FBS and antibiotic-antimycotic solution (Life Technologies)

Lung (NCI-H23, A549, NCI-H358, Calu-1, NCI-H460, and NCI-H1299), breast (SK-BR-3, MCF-7, and MDA-MB-231), colorectal (HCT116), hepatocellular (SK-HEP-1), and cervical (HeLa) cancer cells were obtained from the Korean Cell Line Bank (Seoul, Korea). Melanoma cell lines (A375 and A2058) were obtained from the American Type Culture Collection (Manassas, VA, USA). Cells were cultured in 10% fetal bovine serum (FBS) as well as penicillin/streptomycin-contained Dulbecco’s modified Eagle’s medium (DMEM) and Roswell Park Memorial Institute (RPMI) 1640 at both 20% O2 and 5% CO2. Cell culture medium, FBS, and antibiotics were purchased from HyClone Thermo Scientific (Waltham, MA, USA). Simvastatin (S6196), Lovastatin (438185), Lonafarnib (SML1457), and GGTI-2133 (G5294) were purchased from Sigma Aldrich (St. Louis, MO, USA). Atorvastatin (S5715), Fluvastatin (S2061), and MK-2206 (S1078) were obtained from Selleckchem (Houston, TX, USA). All chemicals stock solution was dissolved in dimethyl sulfoxide (DMSO).

The human lung carcinoma cell line NCI-H460 was obtained from the Korean cell line bank (Seoul, Korea). Cells were cultured in RPMI-1640 (Thermo-fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum, 1% penicillin–streptomycin, and 0.2% NaHCO₃, and grown in a 5% CO₂ incubator at 37 °C.

HUVEC-C, 143B, A-549, HeLa, U2OS, and 4T1 cell lines were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). Caki-1, DU145, HT-29, HCT 116, MCF-7, NCI-H23, NCI-H522, NCI-H460, PC-3, SK-MEL-2, SK-MEL-5, SK-MEL-28, U-87MG, CT-26, and RenCa were obtained from the Korean Cell Line Bank (KCLB, Seoul, Korea). The cells were maintained with ATCC and KCLB recommended media, respectively, and supplemented with 10% fetal bovine serum (FBS). The Wyeth-calf adapted strain VACV (VR-1536, New York City Department of Health Laboratories) was purchased from the ATCC, amplified in HeLa cells, and quantified while using a VACV titration protocol [40 (link)]. In this study, all of the incubation and infection steps were performed at 37 °C in 5% CO₂, and all chemicals were purchased from Sigma-Aldrich (Merck KGaA, Darmstadt, Germany), unless otherwise specified.

Human osteosarcoma (143B and U-2 OS), human cervical adenocarcinoma (HeLa and HeLa S3), human epithelial lung carcinoma (A549), murine colorectal cancer cell (CT-26.WT), and murine breast carcinoma (4T1) cell lines were purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA). Human lung carcinoma (NCI-H460), human normal lung fibroblast (MRC-5), human kidney carcinoma (A-498 and Caki-1), human colorectal adenocarcinoma (HCT 116), human metastatic breast carcinoma (MDA-MB-231 and MCF7), and murine renal adenocarcinoma (Renca) were obtained from the Korean Cell Line Bank (KCLB, Chongno-gu, Seoul, Korea). All cell lines were maintained with ATCC and KCLB recommended media, respectively, and supplemented with 10% fetal bovine serum (FBS). The NIH TC-adapted WR strain of VV (VR-1354, ATCC; Manassas, VA, USA) was purchased from the ATCC, amplified in HeLa or HeLa S3 cells, and quantified using a vaccinia virus titration protocol. WR-GFP is a tk deleted and green fluorescence protein armed tk-deleted WR VV obtained from Professor Kim Jae-Ho, Pusan National University, South Korea. All cell lines and viruses were cultured under appropriate conditions and were routinely tested for sterility and mycoplasma contamination using MycoAlert assay kit (Lonza, Rockland, ME, USA).